ID: 1073907976

View in Genome Browser
Species Human (GRCh38)
Location 10:108306377-108306399
Sequence GGATAGACACAAGATCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073907976_1073907979 12 Left 1073907976 10:108306377-108306399 CCAAACTGATCTTGTGTCTATCC No data
Right 1073907979 10:108306412-108306434 GCAAATATTCACAATCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073907976 Original CRISPR GGATAGACACAAGATCAGTT TGG (reversed) Intergenic
No off target data available for this crispr