ID: 1073919833

View in Genome Browser
Species Human (GRCh38)
Location 10:108445972-108445994
Sequence CTCCATAACACACTTTTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073919829_1073919833 19 Left 1073919829 10:108445930-108445952 CCATGAGGAGGTTGGCTAGATGA No data
Right 1073919833 10:108445972-108445994 CTCCATAACACACTTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073919833 Original CRISPR CTCCATAACACACTTTTGTT TGG Intergenic
No off target data available for this crispr