ID: 1073927518

View in Genome Browser
Species Human (GRCh38)
Location 10:108534127-108534149
Sequence TCGCTATGTTGGGGAAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073927518_1073927524 1 Left 1073927518 10:108534127-108534149 CCAGAACTTCCCCAACATAGCGA No data
Right 1073927524 10:108534151-108534173 GCTGGCCAACATTCAAATTCAGG No data
1073927518_1073927526 9 Left 1073927518 10:108534127-108534149 CCAGAACTTCCCCAACATAGCGA No data
Right 1073927526 10:108534159-108534181 ACATTCAAATTCAGGAAATATGG 0: 80
1: 78
2: 48
3: 89
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073927518 Original CRISPR TCGCTATGTTGGGGAAGTTC TGG (reversed) Intergenic
No off target data available for this crispr