ID: 1073929125

View in Genome Browser
Species Human (GRCh38)
Location 10:108554422-108554444
Sequence TCATTACCACAAGAAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073929125_1073929127 -8 Left 1073929125 10:108554422-108554444 CCATGCTCTTCTTGTGGTAATGA No data
Right 1073929127 10:108554437-108554459 GGTAATGAGTGAAACTCAGGAGG No data
1073929125_1073929128 0 Left 1073929125 10:108554422-108554444 CCATGCTCTTCTTGTGGTAATGA No data
Right 1073929128 10:108554445-108554467 GTGAAACTCAGGAGGTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073929125 Original CRISPR TCATTACCACAAGAAGAGCA TGG (reversed) Intergenic
No off target data available for this crispr