ID: 1073930971

View in Genome Browser
Species Human (GRCh38)
Location 10:108576342-108576364
Sequence TCTGAGGTACATGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073930965_1073930971 22 Left 1073930965 10:108576297-108576319 CCCAGAATTCTGAAGAAAGGGTG No data
Right 1073930971 10:108576342-108576364 TCTGAGGTACATGAGGAGGATGG No data
1073930966_1073930971 21 Left 1073930966 10:108576298-108576320 CCAGAATTCTGAAGAAAGGGTGC No data
Right 1073930971 10:108576342-108576364 TCTGAGGTACATGAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073930971 Original CRISPR TCTGAGGTACATGAGGAGGA TGG Intergenic
No off target data available for this crispr