ID: 1073935238

View in Genome Browser
Species Human (GRCh38)
Location 10:108623435-108623457
Sequence TCCACCTTAGGGTAGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073935238_1073935241 4 Left 1073935238 10:108623435-108623457 CCTTCTATCTACCCTAAGGTGGA No data
Right 1073935241 10:108623462-108623484 AACATCCACCACCAAAGAATAGG No data
1073935238_1073935242 5 Left 1073935238 10:108623435-108623457 CCTTCTATCTACCCTAAGGTGGA No data
Right 1073935242 10:108623463-108623485 ACATCCACCACCAAAGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073935238 Original CRISPR TCCACCTTAGGGTAGATAGA AGG (reversed) Intergenic
No off target data available for this crispr