ID: 1073935336

View in Genome Browser
Species Human (GRCh38)
Location 10:108624645-108624667
Sequence ATGTTGGTATAGAGGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073935336_1073935345 24 Left 1073935336 10:108624645-108624667 CCAGATCCCCTCTATACCAACAT No data
Right 1073935345 10:108624692-108624714 CCATTATCAGAAATGAACATGGG No data
1073935336_1073935342 -1 Left 1073935336 10:108624645-108624667 CCAGATCCCCTCTATACCAACAT No data
Right 1073935342 10:108624667-108624689 TGATAGCACAGTTTATTGGATGG No data
1073935336_1073935343 23 Left 1073935336 10:108624645-108624667 CCAGATCCCCTCTATACCAACAT No data
Right 1073935343 10:108624691-108624713 TCCATTATCAGAAATGAACATGG No data
1073935336_1073935341 -5 Left 1073935336 10:108624645-108624667 CCAGATCCCCTCTATACCAACAT No data
Right 1073935341 10:108624663-108624685 AACATGATAGCACAGTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073935336 Original CRISPR ATGTTGGTATAGAGGGGATC TGG (reversed) Intergenic
No off target data available for this crispr