ID: 1073935959

View in Genome Browser
Species Human (GRCh38)
Location 10:108632228-108632250
Sequence AAGATTCTGATGACCTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073935957_1073935959 3 Left 1073935957 10:108632202-108632224 CCTAGTACTTGACACAACACATC No data
Right 1073935959 10:108632228-108632250 AAGATTCTGATGACCTCTGGTGG No data
1073935955_1073935959 30 Left 1073935955 10:108632175-108632197 CCTCTGTTTCTTATTATATATAG No data
Right 1073935959 10:108632228-108632250 AAGATTCTGATGACCTCTGGTGG No data
1073935956_1073935959 4 Left 1073935956 10:108632201-108632223 CCCTAGTACTTGACACAACACAT No data
Right 1073935959 10:108632228-108632250 AAGATTCTGATGACCTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073935959 Original CRISPR AAGATTCTGATGACCTCTGG TGG Intergenic
No off target data available for this crispr