ID: 1073937953

View in Genome Browser
Species Human (GRCh38)
Location 10:108657523-108657545
Sequence CTGTGTATGTAGAAATTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073937950_1073937953 9 Left 1073937950 10:108657491-108657513 CCTTCCCTAAGAATAAATGAGTT No data
Right 1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG No data
1073937949_1073937953 10 Left 1073937949 10:108657490-108657512 CCCTTCCCTAAGAATAAATGAGT No data
Right 1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG No data
1073937952_1073937953 4 Left 1073937952 10:108657496-108657518 CCTAAGAATAAATGAGTTAAATG No data
Right 1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG No data
1073937951_1073937953 5 Left 1073937951 10:108657495-108657517 CCCTAAGAATAAATGAGTTAAAT No data
Right 1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073937953 Original CRISPR CTGTGTATGTAGAAATTTTA TGG Intergenic
No off target data available for this crispr