ID: 1073938911

View in Genome Browser
Species Human (GRCh38)
Location 10:108670743-108670765
Sequence GTAGAGCCCTAGAATTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073938911_1073938916 9 Left 1073938911 10:108670743-108670765 CCATTTTAATTCTAGGGCTCTAC No data
Right 1073938916 10:108670775-108670797 AATGACCAGCCTGGTATAATTGG No data
1073938911_1073938917 10 Left 1073938911 10:108670743-108670765 CCATTTTAATTCTAGGGCTCTAC No data
Right 1073938917 10:108670776-108670798 ATGACCAGCCTGGTATAATTGGG No data
1073938911_1073938912 0 Left 1073938911 10:108670743-108670765 CCATTTTAATTCTAGGGCTCTAC No data
Right 1073938912 10:108670766-108670788 ATTCCCCTTAATGACCAGCCTGG No data
1073938911_1073938918 13 Left 1073938911 10:108670743-108670765 CCATTTTAATTCTAGGGCTCTAC No data
Right 1073938918 10:108670779-108670801 ACCAGCCTGGTATAATTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073938911 Original CRISPR GTAGAGCCCTAGAATTAAAA TGG (reversed) Intergenic
No off target data available for this crispr