ID: 1073941389

View in Genome Browser
Species Human (GRCh38)
Location 10:108702777-108702799
Sequence TTGTCACCTGCTATATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073941389_1073941390 22 Left 1073941389 10:108702777-108702799 CCAAGAAATATAGCAGGTGACAA No data
Right 1073941390 10:108702822-108702844 ATGTGTGTGCTGATGTACGTAGG No data
1073941389_1073941391 25 Left 1073941389 10:108702777-108702799 CCAAGAAATATAGCAGGTGACAA No data
Right 1073941391 10:108702825-108702847 TGTGTGCTGATGTACGTAGGAGG No data
1073941389_1073941392 28 Left 1073941389 10:108702777-108702799 CCAAGAAATATAGCAGGTGACAA No data
Right 1073941392 10:108702828-108702850 GTGCTGATGTACGTAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073941389 Original CRISPR TTGTCACCTGCTATATTTCT TGG (reversed) Intergenic
No off target data available for this crispr