ID: 1073941389 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:108702777-108702799 |
| Sequence | TTGTCACCTGCTATATTTCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1073941389_1073941390 | 22 | Left | 1073941389 | 10:108702777-108702799 | CCAAGAAATATAGCAGGTGACAA | No data | ||
| Right | 1073941390 | 10:108702822-108702844 | ATGTGTGTGCTGATGTACGTAGG | No data | ||||
| 1073941389_1073941391 | 25 | Left | 1073941389 | 10:108702777-108702799 | CCAAGAAATATAGCAGGTGACAA | No data | ||
| Right | 1073941391 | 10:108702825-108702847 | TGTGTGCTGATGTACGTAGGAGG | No data | ||||
| 1073941389_1073941392 | 28 | Left | 1073941389 | 10:108702777-108702799 | CCAAGAAATATAGCAGGTGACAA | No data | ||
| Right | 1073941392 | 10:108702828-108702850 | GTGCTGATGTACGTAGGAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1073941389 | Original CRISPR | TTGTCACCTGCTATATTTCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||