ID: 1073941390

View in Genome Browser
Species Human (GRCh38)
Location 10:108702822-108702844
Sequence ATGTGTGTGCTGATGTACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073941389_1073941390 22 Left 1073941389 10:108702777-108702799 CCAAGAAATATAGCAGGTGACAA No data
Right 1073941390 10:108702822-108702844 ATGTGTGTGCTGATGTACGTAGG No data
1073941388_1073941390 26 Left 1073941388 10:108702773-108702795 CCAGCCAAGAAATATAGCAGGTG No data
Right 1073941390 10:108702822-108702844 ATGTGTGTGCTGATGTACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073941390 Original CRISPR ATGTGTGTGCTGATGTACGT AGG Intergenic
No off target data available for this crispr