ID: 1073947926

View in Genome Browser
Species Human (GRCh38)
Location 10:108773579-108773601
Sequence CTTCATGTGTTCAGCTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073947923_1073947926 -8 Left 1073947923 10:108773564-108773586 CCATCCTCAAGGATCCTTCATGT No data
Right 1073947926 10:108773579-108773601 CTTCATGTGTTCAGCTGTCCTGG No data
1073947921_1073947926 12 Left 1073947921 10:108773544-108773566 CCATGCTCTCTCTGGCTATGCCA No data
Right 1073947926 10:108773579-108773601 CTTCATGTGTTCAGCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073947926 Original CRISPR CTTCATGTGTTCAGCTGTCC TGG Intergenic
No off target data available for this crispr