ID: 1073947927

View in Genome Browser
Species Human (GRCh38)
Location 10:108773582-108773604
Sequence CATGTGTTCAGCTGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073947921_1073947927 15 Left 1073947921 10:108773544-108773566 CCATGCTCTCTCTGGCTATGCCA No data
Right 1073947927 10:108773582-108773604 CATGTGTTCAGCTGTCCTGGAGG No data
1073947923_1073947927 -5 Left 1073947923 10:108773564-108773586 CCATCCTCAAGGATCCTTCATGT No data
Right 1073947927 10:108773582-108773604 CATGTGTTCAGCTGTCCTGGAGG No data
1073947924_1073947927 -9 Left 1073947924 10:108773568-108773590 CCTCAAGGATCCTTCATGTGTTC No data
Right 1073947927 10:108773582-108773604 CATGTGTTCAGCTGTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073947927 Original CRISPR CATGTGTTCAGCTGTCCTGG AGG Intergenic
No off target data available for this crispr