ID: 1073948379

View in Genome Browser
Species Human (GRCh38)
Location 10:108778743-108778765
Sequence AACCCAACCCCATTAAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073948379_1073948381 17 Left 1073948379 10:108778743-108778765 CCACATCTTAATGGGGTTGGGTT No data
Right 1073948381 10:108778783-108778805 CCTAAGTTCCACATAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073948379 Original CRISPR AACCCAACCCCATTAAGATG TGG (reversed) Intergenic
No off target data available for this crispr