ID: 1073952838

View in Genome Browser
Species Human (GRCh38)
Location 10:108830425-108830447
Sequence TAGATTGCAGGAGTGGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073952828_1073952838 29 Left 1073952828 10:108830373-108830395 CCTCGGGGCACTTACAATTATGG No data
Right 1073952838 10:108830425-108830447 TAGATTGCAGGAGTGGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073952838 Original CRISPR TAGATTGCAGGAGTGGGTTG AGG Intergenic
No off target data available for this crispr