ID: 1073952948

View in Genome Browser
Species Human (GRCh38)
Location 10:108831848-108831870
Sequence TGTCCTTTCCAGGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073952944_1073952948 15 Left 1073952944 10:108831810-108831832 CCACGGAATAGTATGCAGCCATA No data
Right 1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG No data
1073952945_1073952948 -3 Left 1073952945 10:108831828-108831850 CCATAAATAGAATGAGATCATGT No data
Right 1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073952948 Original CRISPR TGTCCTTTCCAGGACATGGA TGG Intergenic
No off target data available for this crispr