ID: 1073956216

View in Genome Browser
Species Human (GRCh38)
Location 10:108874375-108874397
Sequence ATTTTGCCCTGGGAGGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073956208_1073956216 8 Left 1073956208 10:108874344-108874366 CCCAAGAAAGGCATCTTCTTAGG No data
Right 1073956216 10:108874375-108874397 ATTTTGCCCTGGGAGGGCAAGGG No data
1073956210_1073956216 7 Left 1073956210 10:108874345-108874367 CCAAGAAAGGCATCTTCTTAGGT No data
Right 1073956216 10:108874375-108874397 ATTTTGCCCTGGGAGGGCAAGGG No data
1073956207_1073956216 17 Left 1073956207 10:108874335-108874357 CCATTCTATCCCAAGAAAGGCAT No data
Right 1073956216 10:108874375-108874397 ATTTTGCCCTGGGAGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073956216 Original CRISPR ATTTTGCCCTGGGAGGGCAA GGG Intergenic
No off target data available for this crispr