ID: 1073957686

View in Genome Browser
Species Human (GRCh38)
Location 10:108891655-108891677
Sequence AGTTATCTGCAGAAGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073957679_1073957686 16 Left 1073957679 10:108891616-108891638 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG No data
1073957680_1073957686 15 Left 1073957680 10:108891617-108891639 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG No data
1073957682_1073957686 4 Left 1073957682 10:108891628-108891650 CCAAGAGCTGTCTCTCAAAAGGG No data
Right 1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG No data
1073957678_1073957686 22 Left 1073957678 10:108891610-108891632 CCGAGGCCCAGTAACAGGCCAAG No data
Right 1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073957686 Original CRISPR AGTTATCTGCAGAAGATGGT AGG Intergenic
No off target data available for this crispr