ID: 1073959155

View in Genome Browser
Species Human (GRCh38)
Location 10:108906057-108906079
Sequence CTAATCTGCAGGTTAATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073959155_1073959163 23 Left 1073959155 10:108906057-108906079 CCAAAAATTAACCTGCAGATTAG No data
Right 1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG No data
1073959155_1073959160 3 Left 1073959155 10:108906057-108906079 CCAAAAATTAACCTGCAGATTAG No data
Right 1073959160 10:108906083-108906105 TGAGCTGCCACACCTGCTCAGGG No data
1073959155_1073959164 24 Left 1073959155 10:108906057-108906079 CCAAAAATTAACCTGCAGATTAG No data
Right 1073959164 10:108906104-108906126 GGTTGTTATCTGCCTTTTCTGGG No data
1073959155_1073959165 25 Left 1073959155 10:108906057-108906079 CCAAAAATTAACCTGCAGATTAG No data
Right 1073959165 10:108906105-108906127 GTTGTTATCTGCCTTTTCTGGGG No data
1073959155_1073959159 2 Left 1073959155 10:108906057-108906079 CCAAAAATTAACCTGCAGATTAG No data
Right 1073959159 10:108906082-108906104 CTGAGCTGCCACACCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073959155 Original CRISPR CTAATCTGCAGGTTAATTTT TGG (reversed) Intergenic