ID: 1073959157

View in Genome Browser
Species Human (GRCh38)
Location 10:108906080-108906102
Sequence TGAGCAGGTGTGGCAGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073959157_1073959164 1 Left 1073959157 10:108906080-108906102 CCCTGAGCTGCCACACCTGCTCA No data
Right 1073959164 10:108906104-108906126 GGTTGTTATCTGCCTTTTCTGGG No data
1073959157_1073959163 0 Left 1073959157 10:108906080-108906102 CCCTGAGCTGCCACACCTGCTCA No data
Right 1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG No data
1073959157_1073959165 2 Left 1073959157 10:108906080-108906102 CCCTGAGCTGCCACACCTGCTCA No data
Right 1073959165 10:108906105-108906127 GTTGTTATCTGCCTTTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073959157 Original CRISPR TGAGCAGGTGTGGCAGCTCA GGG (reversed) Intergenic