ID: 1073959158

View in Genome Browser
Species Human (GRCh38)
Location 10:108906081-108906103
Sequence CTGAGCAGGTGTGGCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073959158_1073959164 0 Left 1073959158 10:108906081-108906103 CCTGAGCTGCCACACCTGCTCAG No data
Right 1073959164 10:108906104-108906126 GGTTGTTATCTGCCTTTTCTGGG No data
1073959158_1073959165 1 Left 1073959158 10:108906081-108906103 CCTGAGCTGCCACACCTGCTCAG No data
Right 1073959165 10:108906105-108906127 GTTGTTATCTGCCTTTTCTGGGG No data
1073959158_1073959163 -1 Left 1073959158 10:108906081-108906103 CCTGAGCTGCCACACCTGCTCAG No data
Right 1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073959158 Original CRISPR CTGAGCAGGTGTGGCAGCTC AGG (reversed) Intergenic