ID: 1073959161

View in Genome Browser
Species Human (GRCh38)
Location 10:108906090-108906112
Sequence ATAACAACCCTGAGCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073959161_1073959167 22 Left 1073959161 10:108906090-108906112 CCACACCTGCTCAGGGTTGTTAT No data
Right 1073959167 10:108906135-108906157 TAAGCTTGTATCATTTACCGTGG No data
1073959161_1073959163 -10 Left 1073959161 10:108906090-108906112 CCACACCTGCTCAGGGTTGTTAT No data
Right 1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG No data
1073959161_1073959164 -9 Left 1073959161 10:108906090-108906112 CCACACCTGCTCAGGGTTGTTAT No data
Right 1073959164 10:108906104-108906126 GGTTGTTATCTGCCTTTTCTGGG No data
1073959161_1073959165 -8 Left 1073959161 10:108906090-108906112 CCACACCTGCTCAGGGTTGTTAT No data
Right 1073959165 10:108906105-108906127 GTTGTTATCTGCCTTTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073959161 Original CRISPR ATAACAACCCTGAGCAGGTG TGG (reversed) Intergenic