ID: 1073959163

View in Genome Browser
Species Human (GRCh38)
Location 10:108906103-108906125
Sequence GGGTTGTTATCTGCCTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073959155_1073959163 23 Left 1073959155 10:108906057-108906079 CCAAAAATTAACCTGCAGATTAG No data
Right 1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG No data
1073959157_1073959163 0 Left 1073959157 10:108906080-108906102 CCCTGAGCTGCCACACCTGCTCA No data
Right 1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG No data
1073959161_1073959163 -10 Left 1073959161 10:108906090-108906112 CCACACCTGCTCAGGGTTGTTAT No data
Right 1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG No data
1073959158_1073959163 -1 Left 1073959158 10:108906081-108906103 CCTGAGCTGCCACACCTGCTCAG No data
Right 1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG No data
1073959156_1073959163 12 Left 1073959156 10:108906068-108906090 CCTGCAGATTAGCCCTGAGCTGC No data
Right 1073959163 10:108906103-108906125 GGGTTGTTATCTGCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073959163 Original CRISPR GGGTTGTTATCTGCCTTTTC TGG Intergenic