ID: 1073960689

View in Genome Browser
Species Human (GRCh38)
Location 10:108924141-108924163
Sequence CGCTGTGTGGGTAAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073960689 Original CRISPR CGCTGTGTGGGTAAGGCTGC TGG (reversed) Intergenic
902334029 1:15744623-15744645 CTCTGTCTGGGTCAGGCTCCGGG + Intronic
902784226 1:18722615-18722637 CCCTGTGTGGGTGAGGCGGCAGG + Intronic
903183608 1:21617652-21617674 CGCTGTCTGGGTCTGGCTGAGGG - Intronic
903833488 1:26188643-26188665 CGCTGTGTGGGGGTGGCTGCAGG - Exonic
904208303 1:28869273-28869295 GGCTGTGTGGTTCAGGCTGCAGG + Intergenic
905335389 1:37241173-37241195 CGCTGTGTGGAGCAAGCTGCTGG - Intergenic
905367441 1:37461132-37461154 CACTGTGTTGGCAAGGCTGTTGG + Intergenic
905394273 1:37657224-37657246 CGGGGTGTGGGGAAGGCTGAGGG + Intergenic
906147007 1:43566135-43566157 CGTGGTGTGGGGGAGGCTGCCGG + Intronic
907046530 1:51303256-51303278 AGCTGTGTGGGCAGTGCTGCCGG + Intronic
907404476 1:54245452-54245474 CTCTGTGTGTGTCAGGCTCCAGG - Intronic
907405236 1:54250017-54250039 TGCTGTGTGGCTTAGGCTGTGGG + Intronic
908186103 1:61654630-61654652 TGCTGTGCGGGAAAGGCTGCTGG + Intergenic
910135816 1:83968003-83968025 TGGTGTGTGGGAACGGCTGCAGG - Intronic
910254971 1:85238866-85238888 CACTCTGTTGGTAAGGCAGCGGG - Intergenic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
915243707 1:154541725-154541747 CCCTGTCTGGGGAAGGCTGCTGG + Intronic
917370610 1:174289833-174289855 CTCTGGTTGGGTGAGGCTGCAGG + Intronic
918058707 1:181044531-181044553 CGCTCTGTGGGAAAGGATGTGGG - Intronic
922763460 1:228146101-228146123 CCCAGTGTGGGCAGGGCTGCTGG + Intronic
922816003 1:228449878-228449900 GACTGTGTGGGTAAAGCTCCTGG + Intergenic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
1063685703 10:8235668-8235690 TGCTGTGTGGAGGAGGCTGCAGG + Intergenic
1065820725 10:29522812-29522834 TGCTGTGTGGGTAACCCTCCAGG - Intronic
1067104665 10:43358129-43358151 CACTGTGTTGGCCAGGCTGCTGG - Intergenic
1067716057 10:48691893-48691915 CCCTGTGTGCAGAAGGCTGCAGG + Intronic
1067943735 10:50677638-50677660 CCCTGTGTGGGCGAGGCTGGGGG + Intergenic
1069613197 10:69789163-69789185 CTCTGTGTGGGGAAGGCTGTGGG + Intergenic
1070356772 10:75647614-75647636 CCCTGTATGGGTATGGCTTCTGG + Intronic
1070814998 10:79317377-79317399 GGCGGTGTGGGGGAGGCTGCAGG + Intergenic
1071955324 10:90751407-90751429 CCATGTCTGGGAAAGGCTGCTGG - Intronic
1073960689 10:108924141-108924163 CGCTGTGTGGGTAAGGCTGCTGG - Intergenic
1074010605 10:109475090-109475112 TGCTGTGTGGGAATGGCAGCAGG + Intergenic
1075323592 10:121512019-121512041 CGCTGTGTGTGTATGGGTGTTGG + Intronic
1075780747 10:125015676-125015698 CGCTGTGTGGATACCGCTGGTGG + Intronic
1076405826 10:130212068-130212090 TGCTGTGTGGGCAAGGGTGATGG + Intergenic
1077176838 11:1194980-1195002 CGCGGTGGGGGTCAGGCTGCTGG - Intronic
1078142498 11:8702395-8702417 CCCTGTGTGGGTGAGGGAGCAGG - Intronic
1084350619 11:68596454-68596476 AGCTGTGTGGGTCTGGCTGGAGG + Intronic
1085446167 11:76602600-76602622 GGCTGGGTGGGAAAGGCTGTGGG + Intergenic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091540596 12:1457858-1457880 CGCTCTGTGGCTCAGGCTGGAGG - Intronic
1091792946 12:3281833-3281855 AGCAGGGTGGGTGAGGCTGCTGG - Intronic
1091884972 12:4010177-4010199 CACTCTGTGGTTAAGGCGGCTGG + Intergenic
1091896745 12:4111065-4111087 TGCTGGGTGGGTCAGGCTGGTGG - Intergenic
1092478506 12:8839284-8839306 AGCTATGTGGCTATGGCTGCAGG - Intronic
1096513509 12:52144597-52144619 ATCTGTGGGGGTCAGGCTGCTGG + Intergenic
1097306137 12:58071238-58071260 TGAGCTGTGGGTAAGGCTGCTGG + Intergenic
1103693457 12:122794864-122794886 CGCTATGTGGCCCAGGCTGCTGG + Intronic
1106998660 13:35518826-35518848 CGGTGTGGGGGGAAGGTTGCAGG + Intronic
1110039117 13:70729524-70729546 AGCTGTGTGGGTAAGCCATCTGG + Intergenic
1114804179 14:25815069-25815091 GGCAATGTGGGAAAGGCTGCTGG - Intergenic
1115034204 14:28837707-28837729 CAATGTGTTGATAAGGCTGCAGG - Intergenic
1115094488 14:29618497-29618519 CGTTGTGTGGCTGAGGCAGCCGG - Intronic
1121719417 14:96098766-96098788 TCCTGTGTGGGCAAAGCTGCTGG - Intergenic
1122999266 14:105283466-105283488 CACTGTGTGGGGGAAGCTGCGGG - Intronic
1127117437 15:55742617-55742639 CGCTGCTTGGGCAGGGCTGCGGG - Intronic
1129771025 15:78203737-78203759 TGGTCTGTGGGAAAGGCTGCAGG + Intronic
1130444377 15:83986051-83986073 GGCAGTGTTGGTAAGACTGCTGG - Intronic
1132302929 15:100787685-100787707 GGGTGTGTGGGGAAGGCAGCAGG - Intergenic
1132509059 16:327883-327905 GACTGGGTGGGAAAGGCTGCAGG + Intronic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1133096728 16:3452236-3452258 CCCTATGTTGGTGAGGCTGCGGG + Intronic
1133096830 16:3452978-3453000 CCCTATGTTGGTGAGGCTGCGGG + Intronic
1133118983 16:3594901-3594923 CACTGAGTGGGACAGGCTGCGGG + Intronic
1134191562 16:12125299-12125321 AGCTGTGTGGGGAAGGCGGAAGG + Intronic
1136366108 16:29809919-29809941 CTCTGTCTGGGTGAGGATGCAGG + Intronic
1138413907 16:56860322-56860344 AGGTGTGTGGGTAAGGATGGAGG - Intergenic
1139719553 16:68841552-68841574 CACTGTGTGGGGAAGGCTTGAGG - Intergenic
1141087535 16:81107604-81107626 CGCTGTGTGGGTGGTGCTGGTGG + Intergenic
1142323027 16:89397138-89397160 GGCTCTGTGGGTATGTCTGCTGG - Intronic
1144641461 17:16939606-16939628 GGATGTGTGGGCAAGGCTGCAGG + Exonic
1145971787 17:28960492-28960514 CGCTATGAGGGTGAGCCTGCTGG - Exonic
1148554291 17:48568984-48569006 CGCGGTGTGGCTCCGGCTGCGGG + Intronic
1150292592 17:63990351-63990373 CGATGTGAGGGTACGGCTGTGGG - Intergenic
1150669296 17:67176710-67176732 CGCTGAGTGGCTGAGACTGCAGG - Intronic
1151508912 17:74546447-74546469 CGCTGTGTGTGTAGGTCTGGGGG - Intergenic
1153475683 18:5496000-5496022 CACTGTGTGGGTCAGGCTGAAGG + Intronic
1153767456 18:8387898-8387920 CAATGTGCAGGTAAGGCTGCGGG - Intronic
1157578454 18:48759254-48759276 TGCTGTGTGGGAATGGCTGTGGG - Intronic
1159883506 18:73882313-73882335 GGCTGTGTGGGTGGTGCTGCTGG + Intergenic
1160672427 19:372534-372556 TGCTGTGTGGGAAAGGGTCCAGG - Intronic
1160781703 19:880348-880370 AGCAGTGTGGCCAAGGCTGCTGG - Intronic
1161375358 19:3937044-3937066 CGCTGTGTGGGTGTGGGTGGGGG + Intronic
1162629403 19:11915170-11915192 CGCTGTGTCGACTAGGCTGCAGG - Intergenic
1162990786 19:14300829-14300851 CGCTCTGTAGCTCAGGCTGCTGG + Intergenic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1163685368 19:18709248-18709270 CCCTGTGTGAGGGAGGCTGCGGG - Intronic
925249957 2:2423867-2423889 TACTGTGTGGGGAAGGCTACAGG + Intergenic
925250392 2:2430867-2430889 GGTTATGTGGGCAAGGCTGCAGG + Intergenic
926238878 2:11069750-11069772 CTCTGTGTGGGTGGGGGTGCAGG + Intergenic
927987539 2:27423175-27423197 CTCAGTGTTGGTAAGGATGCAGG - Intergenic
928823339 2:35390045-35390067 CTCTGTGAGGTTGAGGCTGCAGG + Intergenic
929204459 2:39275239-39275261 CACTGGGTGGGTAAGGCAGAAGG + Intronic
930951143 2:57145667-57145689 TGCTGTGTGGGTAAGTCCCCAGG - Intergenic
932593539 2:73080825-73080847 CAGTGTGTGGGAGAGGCTGCCGG - Intronic
938774883 2:134532711-134532733 CACTGTGTGGGCACAGCTGCAGG - Intronic
940671609 2:156676335-156676357 AACTGTGTGGGTAAAGCTGGTGG - Intergenic
947090469 2:226504595-226504617 CGCTCTGTTGCTCAGGCTGCTGG - Intergenic
948084838 2:235238809-235238831 CTGTGTGTGGGTGGGGCTGCTGG + Intergenic
948825928 2:240573446-240573468 CACTGGGTGGGCCAGGCTGCCGG - Intronic
1168947896 20:1776988-1777010 CGCTGCCAGGGTAAGGGTGCCGG - Intergenic
1169224544 20:3847752-3847774 GGCTGTGTGGGTCTCGCTGCAGG + Intronic
1172043959 20:32066017-32066039 CCCTGTGAGGTTGAGGCTGCTGG + Intronic
1172706620 20:36886930-36886952 TGCAGTGTGGGTATGGCTGTAGG + Intronic
1174431277 20:50471334-50471356 CACTGTGTTGGCAAGCCTGCAGG - Intergenic
1184863570 22:47190506-47190528 CGCTGGGTGGGGAGGGCTCCTGG - Intergenic
950615043 3:14151538-14151560 CGCTTAGTGGGAAAGGCTGCAGG - Intronic
950677050 3:14560612-14560634 AGCTGTGTCAGTCAGGCTGCTGG + Intergenic
952484738 3:33798803-33798825 CGCCGCTTGGGTAAGTCTGCTGG - Exonic
952886976 3:38018003-38018025 CTCTGTGTGGGTGAGGGCGCTGG - Intronic
953414184 3:42706026-42706048 AGCTGGGTGGGGAAGGATGCAGG - Intronic
953982237 3:47418642-47418664 CGCTGTACAAGTAAGGCTGCTGG - Exonic
954590175 3:51776330-51776352 CTCAGTAGGGGTAAGGCTGCTGG - Intergenic
954609023 3:51934502-51934524 GGCAGTGTGGGGAAGGCTTCCGG - Exonic
955066599 3:55538504-55538526 GGCTGTGTGAGCAAAGCTGCTGG + Intronic
960464112 3:117974493-117974515 CGCTGTGTCCGCCAGGCTGCAGG + Intergenic
965032601 3:163391800-163391822 GGCTGTGTGGGTCAGCCTCCAGG - Intergenic
966878221 3:184335624-184335646 CCCTGTGTGGGGAAGGCTTTTGG + Intronic
969422179 4:7103846-7103868 CGCTGTGAGGGAAAAGCTGTGGG + Intergenic
970210326 4:13703280-13703302 CAGTGTGTGGGGAAGGCTGGTGG - Intergenic
972388212 4:38588070-38588092 GGATGTGTGGGTAAGGTAGCTGG - Intergenic
973947172 4:55969995-55970017 TTCTGTGTGGTTAAGACTGCAGG + Intronic
973956441 4:56068014-56068036 CAGTGTGTGTGTGAGGCTGCAGG + Intergenic
976443695 4:85106316-85106338 CCCTGTGTTGCCAAGGCTGCTGG - Intergenic
977588071 4:98797184-98797206 CGCTGTGTTGGCAAGGGTGTGGG + Intergenic
985660533 5:1154980-1155002 CTCTGTGTGGCCAAGGCTGGCGG + Intergenic
989471119 5:41819810-41819832 GGCTCTGTGGGTATAGCTGCTGG + Intronic
994155892 5:96503960-96503982 CTCTCTGTGGGAAAGCCTGCTGG - Intergenic
995664247 5:114523264-114523286 CGCAGTGTGGTTCAGGCTGCTGG - Intergenic
996223463 5:120961089-120961111 CACTGTGTGGGTTAGAGTGCTGG + Intergenic
998566761 5:143222811-143222833 CACTGTGTAGCTAAGCCTGCTGG + Exonic
999192965 5:149762502-149762524 CCATGGGTGGGTCAGGCTGCCGG - Intronic
999246177 5:150155902-150155924 CACTTTGGGGGAAAGGCTGCAGG + Intergenic
1001519564 5:172381470-172381492 CACTGTGTGGCTGGGGCTGCTGG + Intronic
1001814880 5:174660240-174660262 AGCTCTGTGGGCAAGGCTGTTGG - Intergenic
1002316686 5:178348544-178348566 CGCTGTGAGGGTATGCCTGCTGG - Intronic
1004728359 6:18333097-18333119 AGCTGTGTGGTTCAGGCTTCTGG + Intergenic
1006670639 6:35727930-35727952 CGGTGAGTGGGCAGGGCTGCGGG + Intronic
1007236689 6:40395505-40395527 CCCTGTGTGGCCAATGCTGCAGG + Intronic
1007607248 6:43125889-43125911 CTCTGTGTGGGTGAGACTCCTGG + Intronic
1007607786 6:43129051-43129073 CGCTGTGAGGTTGAGGCTCCGGG + Exonic
1007665463 6:43510536-43510558 GGCTGAGTGGGTAGGGCTGACGG + Exonic
1010984175 6:82403194-82403216 AGCTCTGTGGGACAGGCTGCAGG + Intergenic
1011293966 6:85807491-85807513 CACTGTGTTGGCCAGGCTGCTGG + Intergenic
1017021559 6:150143688-150143710 CCCTGTCTGGGTTCGGCTGCCGG + Intronic
1018809564 6:167288074-167288096 CACGGTGTGGTTAAAGCTGCTGG - Intronic
1019357773 7:589943-589965 CCCTGTGAGGGTCAGGCAGCTGG + Intronic
1019737310 7:2656920-2656942 CGCTGTGGGGGAAAGGTTGGTGG + Intronic
1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG + Intronic
1035268753 7:157707285-157707307 TGCTGTGTGTGTAAGTATGCTGG - Intronic
1035521258 8:276397-276419 AGCTGTGTGAGCAATGCTGCTGG - Intergenic
1035794748 8:2344445-2344467 GGCTGTGTGGGAAAGGGTGATGG - Intergenic
1049027977 8:140009954-140009976 CGCTATGCTGGTGAGGCTGCGGG + Intronic
1051060238 9:13037181-13037203 AGCTATGTGGTTAGGGCTGCAGG - Intergenic
1051112276 9:13652411-13652433 CGCTCTGTGGATAAGTCTGTGGG + Intergenic
1051269230 9:15338864-15338886 TCCTCTGTGGGTAATGCTGCTGG + Intergenic
1054715146 9:68549844-68549866 CACTCTGTTGGCAAGGCTGCAGG + Intergenic
1057355482 9:94328073-94328095 CTCTGGGTGGGCAAGGCTGGGGG - Intronic
1057652273 9:96929549-96929571 CTCTGGGTGGGCAAGGCTGGGGG + Intronic
1059373272 9:113861205-113861227 CGCTCTGTTGCTAAGGCTGGAGG + Intergenic
1060964298 9:127703979-127704001 CCCTGGGAGGGGAAGGCTGCTGG - Intronic
1061202214 9:129144383-129144405 CGCTGTGTGGGGAAGGGGACAGG + Intronic
1062304842 9:135899686-135899708 CACCGTGTGGGAAAGGCTGGTGG - Intronic
1062354022 9:136153454-136153476 CGCTGGGTGGGGCAGGCTCCTGG - Intergenic
1062470092 9:136698858-136698880 CGCTGCGTGCGGAAGGCCGCAGG + Intergenic
1062722640 9:138052445-138052467 TGCAGTGCGGGAAAGGCTGCCGG + Intronic
1189350531 X:40272418-40272440 CCCTGTGTGGGCAAGGCTGATGG - Intergenic
1190864529 X:54373651-54373673 CGCTGTGTTGGCCAGGCTGGTGG - Intergenic
1197615292 X:128683758-128683780 AGCTGTGTGGGTGGGGCTGAGGG - Intergenic
1198174201 X:134139115-134139137 CCCTCTGAGGGCAAGGCTGCTGG + Intergenic
1200232838 X:154453008-154453030 CACTGTGTGGGCAAGGCTGGGGG - Intergenic