ID: 1073963441

View in Genome Browser
Species Human (GRCh38)
Location 10:108960677-108960699
Sequence AAAAATCAGAATTTTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073963434_1073963441 25 Left 1073963434 10:108960629-108960651 CCAGTCTCATTCCCTTGTACCTA No data
Right 1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG No data
1073963439_1073963441 -2 Left 1073963439 10:108960656-108960678 CCAACTGGAGAGCTGCATTTTAA No data
Right 1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG No data
1073963435_1073963441 14 Left 1073963435 10:108960640-108960662 CCCTTGTACCTAAGTGCCAACTG No data
Right 1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG No data
1073963436_1073963441 13 Left 1073963436 10:108960641-108960663 CCTTGTACCTAAGTGCCAACTGG No data
Right 1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG No data
1073963438_1073963441 6 Left 1073963438 10:108960648-108960670 CCTAAGTGCCAACTGGAGAGCTG No data
Right 1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073963441 Original CRISPR AAAAATCAGAATTTTTGGCC AGG Intergenic
No off target data available for this crispr