ID: 1073972928

View in Genome Browser
Species Human (GRCh38)
Location 10:109064996-109065018
Sequence AATAGCTCTCCCTATGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073972928_1073972932 -6 Left 1073972928 10:109064996-109065018 CCCAAATCATAGGGAGAGCTATT No data
Right 1073972932 10:109065013-109065035 GCTATTTTAAGGTCTGGTGAAGG No data
1073972928_1073972933 -5 Left 1073972928 10:109064996-109065018 CCCAAATCATAGGGAGAGCTATT No data
Right 1073972933 10:109065014-109065036 CTATTTTAAGGTCTGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073972928 Original CRISPR AATAGCTCTCCCTATGATTT GGG (reversed) Intergenic
No off target data available for this crispr