ID: 1073973979

View in Genome Browser
Species Human (GRCh38)
Location 10:109078365-109078387
Sequence GTATCAAAAAAGGTGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073973979_1073973985 29 Left 1073973979 10:109078365-109078387 CCTAGCTCCACCTTTTTTGATAC No data
Right 1073973985 10:109078417-109078439 ATATAAATAATTGCAAAATTGGG No data
1073973979_1073973982 -4 Left 1073973979 10:109078365-109078387 CCTAGCTCCACCTTTTTTGATAC No data
Right 1073973982 10:109078384-109078406 ATACTAGCACCTAATAAAAGAGG No data
1073973979_1073973984 28 Left 1073973979 10:109078365-109078387 CCTAGCTCCACCTTTTTTGATAC No data
Right 1073973984 10:109078416-109078438 CATATAAATAATTGCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073973979 Original CRISPR GTATCAAAAAAGGTGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr