ID: 1073976367

View in Genome Browser
Species Human (GRCh38)
Location 10:109106284-109106306
Sequence CATTCCAAGGGCTCTCCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073976364_1073976367 -5 Left 1073976364 10:109106266-109106288 CCACAATTCATTTTGTCACATTC No data
Right 1073976367 10:109106284-109106306 CATTCCAAGGGCTCTCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073976367 Original CRISPR CATTCCAAGGGCTCTCCATA AGG Intergenic
No off target data available for this crispr