ID: 1073977164

View in Genome Browser
Species Human (GRCh38)
Location 10:109115152-109115174
Sequence TCTCACATGTGGCAGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073977162_1073977164 0 Left 1073977162 10:109115129-109115151 CCGGGAAGAGGTCATATGTTTGT No data
Right 1073977164 10:109115152-109115174 TCTCACATGTGGCAGCTCCCAGG No data
1073977158_1073977164 11 Left 1073977158 10:109115118-109115140 CCACCCAAAGCCCGGGAAGAGGT No data
Right 1073977164 10:109115152-109115174 TCTCACATGTGGCAGCTCCCAGG No data
1073977161_1073977164 1 Left 1073977161 10:109115128-109115150 CCCGGGAAGAGGTCATATGTTTG No data
Right 1073977164 10:109115152-109115174 TCTCACATGTGGCAGCTCCCAGG No data
1073977159_1073977164 8 Left 1073977159 10:109115121-109115143 CCCAAAGCCCGGGAAGAGGTCAT No data
Right 1073977164 10:109115152-109115174 TCTCACATGTGGCAGCTCCCAGG No data
1073977160_1073977164 7 Left 1073977160 10:109115122-109115144 CCAAAGCCCGGGAAGAGGTCATA No data
Right 1073977164 10:109115152-109115174 TCTCACATGTGGCAGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073977164 Original CRISPR TCTCACATGTGGCAGCTCCC AGG Intergenic
No off target data available for this crispr