ID: 1073978119

View in Genome Browser
Species Human (GRCh38)
Location 10:109123357-109123379
Sequence ATATATACAAAAATTTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073978114_1073978119 24 Left 1073978114 10:109123310-109123332 CCATCCTGGCTAACACAGTGAAA 0: 13826
1: 44811
2: 48825
3: 61151
4: 157128
Right 1073978119 10:109123357-109123379 ATATATACAAAAATTTAGCTGGG No data
1073978117_1073978119 -1 Left 1073978117 10:109123335-109123357 CCATCTCTACTGAAAAAAATATA No data
Right 1073978119 10:109123357-109123379 ATATATACAAAAATTTAGCTGGG No data
1073978116_1073978119 0 Left 1073978116 10:109123334-109123356 CCCATCTCTACTGAAAAAAATAT No data
Right 1073978119 10:109123357-109123379 ATATATACAAAAATTTAGCTGGG No data
1073978115_1073978119 20 Left 1073978115 10:109123314-109123336 CCTGGCTAACACAGTGAAATCCC 0: 373
1: 12061
2: 42722
3: 68189
4: 129958
Right 1073978119 10:109123357-109123379 ATATATACAAAAATTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073978119 Original CRISPR ATATATACAAAAATTTAGCT GGG Intergenic
No off target data available for this crispr