ID: 1073983280

View in Genome Browser
Species Human (GRCh38)
Location 10:109178799-109178821
Sequence GAGTAGGCCTTCTGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073983275_1073983280 10 Left 1073983275 10:109178766-109178788 CCAGAGCTTTTATTTTTATGGGA No data
Right 1073983280 10:109178799-109178821 GAGTAGGCCTTCTGGGAGGAAGG No data
1073983271_1073983280 21 Left 1073983271 10:109178755-109178777 CCTTTAAAAACCCAGAGCTTTTA No data
Right 1073983280 10:109178799-109178821 GAGTAGGCCTTCTGGGAGGAAGG No data
1073983273_1073983280 11 Left 1073983273 10:109178765-109178787 CCCAGAGCTTTTATTTTTATGGG No data
Right 1073983280 10:109178799-109178821 GAGTAGGCCTTCTGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073983280 Original CRISPR GAGTAGGCCTTCTGGGAGGA AGG Intergenic
No off target data available for this crispr