ID: 1073985214

View in Genome Browser
Species Human (GRCh38)
Location 10:109200570-109200592
Sequence CAGCTCCACCAGCTCTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073985207_1073985214 15 Left 1073985207 10:109200532-109200554 CCTTTACAGCTCCTGCTTCATGG No data
Right 1073985214 10:109200570-109200592 CAGCTCCACCAGCTCTTGTGGGG No data
1073985210_1073985214 4 Left 1073985210 10:109200543-109200565 CCTGCTTCATGGTTGGAATTACT No data
Right 1073985214 10:109200570-109200592 CAGCTCCACCAGCTCTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073985214 Original CRISPR CAGCTCCACCAGCTCTTGTG GGG Intergenic
No off target data available for this crispr