ID: 1073991375

View in Genome Browser
Species Human (GRCh38)
Location 10:109265981-109266003
Sequence CCACACAAGGAGCTATTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073991372_1073991375 3 Left 1073991372 10:109265955-109265977 CCAGCAAGCAAATGAATCACTCA No data
Right 1073991375 10:109265981-109266003 CCACACAAGGAGCTATTGCAAGG No data
1073991371_1073991375 4 Left 1073991371 10:109265954-109265976 CCCAGCAAGCAAATGAATCACTC No data
Right 1073991375 10:109265981-109266003 CCACACAAGGAGCTATTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073991375 Original CRISPR CCACACAAGGAGCTATTGCA AGG Intergenic
No off target data available for this crispr