ID: 1073995875

View in Genome Browser
Species Human (GRCh38)
Location 10:109314719-109314741
Sequence AGTTATCTACAGAAGATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073995873_1073995875 4 Left 1073995873 10:109314692-109314714 CCAAGAGCTATCTCTCAAAAGGA No data
Right 1073995875 10:109314719-109314741 AGTTATCTACAGAAGATAATGGG No data
1073995871_1073995875 15 Left 1073995871 10:109314681-109314703 CCAGTAATAAGCCAAGAGCTATC No data
Right 1073995875 10:109314719-109314741 AGTTATCTACAGAAGATAATGGG No data
1073995868_1073995875 25 Left 1073995868 10:109314671-109314693 CCACCAAAGCCCAGTAATAAGCC No data
Right 1073995875 10:109314719-109314741 AGTTATCTACAGAAGATAATGGG No data
1073995869_1073995875 22 Left 1073995869 10:109314674-109314696 CCAAAGCCCAGTAATAAGCCAAG No data
Right 1073995875 10:109314719-109314741 AGTTATCTACAGAAGATAATGGG No data
1073995870_1073995875 16 Left 1073995870 10:109314680-109314702 CCCAGTAATAAGCCAAGAGCTAT No data
Right 1073995875 10:109314719-109314741 AGTTATCTACAGAAGATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073995875 Original CRISPR AGTTATCTACAGAAGATAAT GGG Intergenic
No off target data available for this crispr