ID: 1073996765

View in Genome Browser
Species Human (GRCh38)
Location 10:109324558-109324580
Sequence CTGGGAGGGCGGAAGGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073996765_1073996776 17 Left 1073996765 10:109324558-109324580 CCCCATCCCTTCCGCCCTCCCAG No data
Right 1073996776 10:109324598-109324620 GAAATGCCATCCAAACCCTCTGG No data
1073996765_1073996778 25 Left 1073996765 10:109324558-109324580 CCCCATCCCTTCCGCCCTCCCAG No data
Right 1073996778 10:109324606-109324628 ATCCAAACCCTCTGGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073996765 Original CRISPR CTGGGAGGGCGGAAGGGATG GGG (reversed) Intergenic
No off target data available for this crispr