ID: 1073997036

View in Genome Browser
Species Human (GRCh38)
Location 10:109327386-109327408
Sequence TTGTATTTAGGGAGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073997036_1073997043 14 Left 1073997036 10:109327386-109327408 CCTCCTCCTCTCCCTAAATACAA No data
Right 1073997043 10:109327423-109327445 ATCTCATTAGCTGTGGGCTGTGG No data
1073997036_1073997042 8 Left 1073997036 10:109327386-109327408 CCTCCTCCTCTCCCTAAATACAA No data
Right 1073997042 10:109327417-109327439 GATAGAATCTCATTAGCTGTGGG No data
1073997036_1073997041 7 Left 1073997036 10:109327386-109327408 CCTCCTCCTCTCCCTAAATACAA No data
Right 1073997041 10:109327416-109327438 AGATAGAATCTCATTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073997036 Original CRISPR TTGTATTTAGGGAGAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr