ID: 1073997540

View in Genome Browser
Species Human (GRCh38)
Location 10:109333068-109333090
Sequence GAAGCATTATAAACCCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073997538_1073997540 0 Left 1073997538 10:109333045-109333067 CCAGGTCTGTTCCTCTTGTATGT No data
Right 1073997540 10:109333068-109333090 GAAGCATTATAAACCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073997540 Original CRISPR GAAGCATTATAAACCCTGCA AGG Intergenic
No off target data available for this crispr