ID: 1074001410

View in Genome Browser
Species Human (GRCh38)
Location 10:109377307-109377329
Sequence GCACCTTGAAGGTGATATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074001403_1074001410 29 Left 1074001403 10:109377255-109377277 CCAGGTTCGACACCAGCACCTTT No data
Right 1074001410 10:109377307-109377329 GCACCTTGAAGGTGATATGTTGG No data
1074001405_1074001410 11 Left 1074001405 10:109377273-109377295 CCTTTTGTTCCAAATGTTTTTTT No data
Right 1074001410 10:109377307-109377329 GCACCTTGAAGGTGATATGTTGG No data
1074001406_1074001410 2 Left 1074001406 10:109377282-109377304 CCAAATGTTTTTTTCACTGTAGG No data
Right 1074001410 10:109377307-109377329 GCACCTTGAAGGTGATATGTTGG No data
1074001404_1074001410 17 Left 1074001404 10:109377267-109377289 CCAGCACCTTTTGTTCCAAATGT No data
Right 1074001410 10:109377307-109377329 GCACCTTGAAGGTGATATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074001410 Original CRISPR GCACCTTGAAGGTGATATGT TGG Intergenic
No off target data available for this crispr