ID: 1074001506

View in Genome Browser
Species Human (GRCh38)
Location 10:109378290-109378312
Sequence CACTATGCACAGAGAGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074001504_1074001506 17 Left 1074001504 10:109378250-109378272 CCAAGCTTAAATGTGTGTCACAG No data
Right 1074001506 10:109378290-109378312 CACTATGCACAGAGAGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074001506 Original CRISPR CACTATGCACAGAGAGTGCT AGG Intergenic
No off target data available for this crispr