ID: 1074001560

View in Genome Browser
Species Human (GRCh38)
Location 10:109378827-109378849
Sequence TCGGGGGACCTAGACTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074001560_1074001571 26 Left 1074001560 10:109378827-109378849 CCCCTTCAGTCTAGGTCCCCCGA No data
Right 1074001571 10:109378876-109378898 CTTAAATGAGCAGCAGTCAAGGG No data
1074001560_1074001564 -7 Left 1074001560 10:109378827-109378849 CCCCTTCAGTCTAGGTCCCCCGA No data
Right 1074001564 10:109378843-109378865 CCCCCGACCACACACAACAGTGG No data
1074001560_1074001570 25 Left 1074001560 10:109378827-109378849 CCCCTTCAGTCTAGGTCCCCCGA No data
Right 1074001570 10:109378875-109378897 TCTTAAATGAGCAGCAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074001560 Original CRISPR TCGGGGGACCTAGACTGAAG GGG (reversed) Intergenic