ID: 1074001564

View in Genome Browser
Species Human (GRCh38)
Location 10:109378843-109378865
Sequence CCCCCGACCACACACAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074001558_1074001564 8 Left 1074001558 10:109378812-109378834 CCATAAGTGTGGGGGCCCCTTCA No data
Right 1074001564 10:109378843-109378865 CCCCCGACCACACACAACAGTGG No data
1074001560_1074001564 -7 Left 1074001560 10:109378827-109378849 CCCCTTCAGTCTAGGTCCCCCGA No data
Right 1074001564 10:109378843-109378865 CCCCCGACCACACACAACAGTGG No data
1074001552_1074001564 29 Left 1074001552 10:109378791-109378813 CCTAAGTAGTTTCAGAGCTGCCC No data
Right 1074001564 10:109378843-109378865 CCCCCGACCACACACAACAGTGG No data
1074001557_1074001564 9 Left 1074001557 10:109378811-109378833 CCCATAAGTGTGGGGGCCCCTTC No data
Right 1074001564 10:109378843-109378865 CCCCCGACCACACACAACAGTGG No data
1074001561_1074001564 -8 Left 1074001561 10:109378828-109378850 CCCTTCAGTCTAGGTCCCCCGAC No data
Right 1074001564 10:109378843-109378865 CCCCCGACCACACACAACAGTGG No data
1074001562_1074001564 -9 Left 1074001562 10:109378829-109378851 CCTTCAGTCTAGGTCCCCCGACC No data
Right 1074001564 10:109378843-109378865 CCCCCGACCACACACAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074001564 Original CRISPR CCCCCGACCACACACAACAG TGG Intergenic
No off target data available for this crispr