ID: 1074001570

View in Genome Browser
Species Human (GRCh38)
Location 10:109378875-109378897
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074001560_1074001570 25 Left 1074001560 10:109378827-109378849 CCCCTTCAGTCTAGGTCCCCCGA No data
Right 1074001570 10:109378875-109378897 TCTTAAATGAGCAGCAGTCAAGG No data
1074001567_1074001570 6 Left 1074001567 10:109378846-109378868 CCGACCACACACAACAGTGGTCC No data
Right 1074001570 10:109378875-109378897 TCTTAAATGAGCAGCAGTCAAGG No data
1074001562_1074001570 23 Left 1074001562 10:109378829-109378851 CCTTCAGTCTAGGTCCCCCGACC No data
Right 1074001570 10:109378875-109378897 TCTTAAATGAGCAGCAGTCAAGG No data
1074001561_1074001570 24 Left 1074001561 10:109378828-109378850 CCCTTCAGTCTAGGTCCCCCGAC No data
Right 1074001570 10:109378875-109378897 TCTTAAATGAGCAGCAGTCAAGG No data
1074001566_1074001570 7 Left 1074001566 10:109378845-109378867 CCCGACCACACACAACAGTGGTC No data
Right 1074001570 10:109378875-109378897 TCTTAAATGAGCAGCAGTCAAGG No data
1074001568_1074001570 2 Left 1074001568 10:109378850-109378872 CCACACACAACAGTGGTCCTAAA No data
Right 1074001570 10:109378875-109378897 TCTTAAATGAGCAGCAGTCAAGG No data
1074001563_1074001570 9 Left 1074001563 10:109378843-109378865 CCCCCGACCACACACAACAGTGG No data
Right 1074001570 10:109378875-109378897 TCTTAAATGAGCAGCAGTCAAGG No data
1074001565_1074001570 8 Left 1074001565 10:109378844-109378866 CCCCGACCACACACAACAGTGGT No data
Right 1074001570 10:109378875-109378897 TCTTAAATGAGCAGCAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074001570 Original CRISPR TCTTAAATGAGCAGCAGTCA AGG Intergenic
No off target data available for this crispr