ID: 1074004648

View in Genome Browser
Species Human (GRCh38)
Location 10:109408170-109408192
Sequence GATGGATTCATTCGTATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074004642_1074004648 7 Left 1074004642 10:109408140-109408162 CCTATTGGGTACTATGCTCACTA 0: 226
1: 756
2: 1385
3: 1939
4: 2112
Right 1074004648 10:109408170-109408192 GATGGATTCATTCGTATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074004648 Original CRISPR GATGGATTCATTCGTATTCC AGG Intergenic
No off target data available for this crispr