ID: 1074006560

View in Genome Browser
Species Human (GRCh38)
Location 10:109431120-109431142
Sequence TTGAATAAGCAGGAAGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074006560_1074006565 14 Left 1074006560 10:109431120-109431142 CCCTGTTCTTCCTGCTTATTCAA No data
Right 1074006565 10:109431157-109431179 CCTGTTTCTGTTTAGAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074006560 Original CRISPR TTGAATAAGCAGGAAGAACA GGG (reversed) Intergenic
No off target data available for this crispr