ID: 1074008941

View in Genome Browser
Species Human (GRCh38)
Location 10:109457043-109457065
Sequence AAGTCGGGCCGCGGCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074008932_1074008941 -9 Left 1074008932 10:109457029-109457051 CCCCAACTCCAGCCAAGTCGGGC No data
Right 1074008941 10:109457043-109457065 AAGTCGGGCCGCGGCGGGGCAGG No data
1074008933_1074008941 -10 Left 1074008933 10:109457030-109457052 CCCAACTCCAGCCAAGTCGGGCC No data
Right 1074008941 10:109457043-109457065 AAGTCGGGCCGCGGCGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074008941 Original CRISPR AAGTCGGGCCGCGGCGGGGC AGG Intergenic