ID: 1074009124

View in Genome Browser
Species Human (GRCh38)
Location 10:109458623-109458645
Sequence AGATGCTGGTGCCATGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1649
Summary {0: 27, 1: 81, 2: 206, 3: 346, 4: 989}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074009124_1074009126 -5 Left 1074009124 10:109458623-109458645 CCAAGAGCATGGCACCAGCATCT 0: 27
1: 81
2: 206
3: 346
4: 989
Right 1074009126 10:109458641-109458663 CATCTGCTCACCATCTGATGAGG No data
1074009124_1074009130 27 Left 1074009124 10:109458623-109458645 CCAAGAGCATGGCACCAGCATCT 0: 27
1: 81
2: 206
3: 346
4: 989
Right 1074009130 10:109458673-109458695 CAGTGTCATCCCATGGAAGAAGG No data
1074009124_1074009129 20 Left 1074009124 10:109458623-109458645 CCAAGAGCATGGCACCAGCATCT 0: 27
1: 81
2: 206
3: 346
4: 989
Right 1074009129 10:109458666-109458688 CCTATTGCAGTGTCATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074009124 Original CRISPR AGATGCTGGTGCCATGCTCT TGG (reversed) Intergenic
900585330 1:3429909-3429931 AGATGCAGGGGTCCTGCTCTTGG - Intronic
900723910 1:4202245-4202267 AGATGCTGGTGCCATGCTCTTGG - Intergenic
900811198 1:4802482-4802504 GGATGCTTGTGCCTTGATCTTGG + Intergenic
900963427 1:5940333-5940355 AGATGCTGGCACCTTGATCTTGG + Intronic
901468653 1:9440479-9440501 AGATGCTGGCGCCTTGATCTTGG - Intergenic
901561505 1:10075365-10075387 AGATGCTGGTGCCTTGGACCTGG - Intronic
901875543 1:12165211-12165233 AGGTGATGGTGCCATTCACTGGG + Intergenic
902145712 1:14397284-14397306 CCATGCTGGTGCCCTGATCTTGG - Intergenic
902899740 1:19506705-19506727 ATCTGCTGGCGCCATGATCTTGG - Intergenic
903551838 1:24162583-24162605 AGATGCCAGTGCCATGCTCTTGG - Intronic
903709274 1:25310424-25310446 AGATGGTGGCACCATGCTTTTGG + Intronic
903717844 1:25382001-25382023 AGATGGTGGCACCATGCTTTTGG - Intronic
904061752 1:27716470-27716492 AGAGGCTAGTGTCATGCTCTTGG + Intergenic
904282568 1:29431384-29431406 AGATGCCAGTGCCATGCTCTTGG + Intergenic
904351765 1:29912610-29912632 AGATGGTGGCACTATGCTCTTGG + Intergenic
904550255 1:31310644-31310666 AGATGCTGGCACCTTGCTCTTGG + Intronic
904830236 1:33301716-33301738 AGATGCTGGCACCATGCTCTTGG - Intergenic
904900717 1:33855079-33855101 TGGTGCTGATGCCAAGCTCTGGG + Intronic
904958882 1:34314860-34314882 ACTTGCTGGTGCCTTGATCTTGG + Intergenic
905382195 1:37570630-37570652 AGATGCTGGTGCCTTGATACTGG + Intronic
905472109 1:38201003-38201025 TGATCCTGGTGCCATGTTCTTGG - Intergenic
905472120 1:38201100-38201122 AGATCCTGGTGCCGTGCTCTTGG - Intergenic
905496808 1:38395775-38395797 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
905696545 1:39978714-39978736 AGATGCTGACACCATGCTCCTGG + Intergenic
905778109 1:40683521-40683543 AAATGCTGGTGCCATGCTCTTGG + Intergenic
905826830 1:41032103-41032125 ATCTGCTGGTGCCTTGATCTTGG + Intronic
905953380 1:41971997-41972019 ATCTGCTGGTGCCTTGATCTTGG + Intronic
906366403 1:45213806-45213828 AGATGTTGGTGCCATGCTCTTGG - Intronic
906441027 1:45844888-45844910 AGATGCTGGTACCTTGATCTTGG - Intronic
906476696 1:46174269-46174291 AGGTGCTTGGGCCATGCTCAAGG - Intronic
906697861 1:47836867-47836889 ATATGCTGGTGCCTTGATCTTGG + Intronic
906785911 1:48615853-48615875 AACTGCTGGTGCCTTGATCTTGG - Intronic
906824384 1:48963121-48963143 AGACACTGGCACCATGCTCTTGG - Intronic
906829106 1:49013059-49013081 AGATGCTGGTGCCATGCCCCTGG + Intronic
907083353 1:51645110-51645132 AGATGCTGGTGCTTGGATCTTGG + Intronic
907330460 1:53667692-53667714 AGATGCTGATGCTTTGGTCTTGG - Intronic
907469031 1:54660181-54660203 AAATGCTGCTGCCTTGATCTTGG - Intronic
907534048 1:55132237-55132259 ATCTGCTGGTGCCTTGATCTTGG + Intronic
907622464 1:55995519-55995541 ACATGCCAGTGCCATGCTCCTGG - Intergenic
907757660 1:57326633-57326655 ATCTGCTGGTGCCTTGCTCTTGG - Intronic
907869904 1:58433480-58433502 AGAAGCTGGTGTCATCTTCTCGG - Intronic
907890450 1:58631643-58631665 AAATGTTGGCGCCATGCTCTTGG + Intergenic
907890703 1:58633669-58633691 AGATGCTGGCACTATGCTCCTGG + Intergenic
908039744 1:60097821-60097843 TGATGTTGGTGGCATGCTGTTGG - Intergenic
908230521 1:62100337-62100359 AGATGCTGGCTCCATGCTCTTGG - Intronic
908262035 1:62346518-62346540 ATCTGCTGGTGCCATCATCTTGG + Intergenic
908388519 1:63664778-63664800 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
908549167 1:65192208-65192230 AGATGCTGACACCATGCTCCTGG - Intronic
908804138 1:67912530-67912552 TGCTGGTGGTGCCATGCTCTTGG + Intergenic
908942826 1:69455938-69455960 AGATGTTGGCACCATGCTCTTGG + Intergenic
909097061 1:71300732-71300754 AGATGCTGGCACCATACTTTTGG + Intergenic
909145938 1:71931485-71931507 AGATGCTGGTACTATGCTGTTGG - Intronic
909205982 1:72758520-72758542 AGGTGCTGGTGCCATGTTCTTGG - Intergenic
909206257 1:72761506-72761528 AGTTGCTGGCACTATGCTCTTGG - Intergenic
909455839 1:75847609-75847631 AGATGCCAATGCCATACTCTTGG - Intronic
909601570 1:77466667-77466689 AGATGCTGGCACCTTGATCTTGG - Intronic
909797674 1:79763278-79763300 AAATGCCAGTGCTATGCTCTTGG - Intergenic
909907116 1:81210815-81210837 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
909939603 1:81595882-81595904 ATCTGCTGGCGCCTTGCTCTTGG - Intronic
910194496 1:84625997-84626019 GGATGCCAGTGCCATACTCTTGG + Intergenic
910219428 1:84875569-84875591 AGATGCCAGTGCCAAGCTCTTGG + Intronic
910258076 1:85269173-85269195 AGATGCTGGCGCCATGGTCTTGG + Intronic
910263423 1:85313531-85313553 AGATGCTGGTACCATGCTCTAGG + Intergenic
910279926 1:85488310-85488332 CCATGCTGGTGCCCTGATCTTGG - Intronic
910377330 1:86586926-86586948 AGATGCTGGGGGCATGAACTAGG - Intergenic
910409099 1:86921689-86921711 AGATGCTGGTGTCTTGATTTTGG + Intronic
910462282 1:87460470-87460492 AGATACAGGTGCCATGCTCTTGG - Intergenic
910544568 1:88399095-88399117 AGATGCTGGCACCTTGATCTGGG + Intergenic
910623299 1:89279496-89279518 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
910732254 1:90411005-90411027 AGATGCTGGGGCCATACTCTTGG - Intergenic
910956488 1:92711901-92711923 ACTTGCTGGTGCCTTGATCTTGG - Intronic
911108297 1:94155605-94155627 ATCTGCTGGTGCCTTGATCTTGG + Intronic
911159825 1:94673067-94673089 TGATGTTGGTGGTATGCTCTTGG + Intergenic
911270433 1:95795200-95795222 GGATGCCAGTGCCATGCCCTTGG - Intergenic
911631203 1:100185532-100185554 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
911789050 1:101988003-101988025 TGATGGTGGTGCTATGTTCTTGG + Intronic
911885429 1:103291683-103291705 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
912364323 1:109120519-109120541 ATCTGCTGGTGCCTTGATCTTGG + Intronic
912367334 1:109145232-109145254 AAATGCTTGTGCCTTGATCTTGG + Intronic
912400198 1:109384708-109384730 AGATGCCTATGCCATACTCTTGG - Intronic
912469891 1:109899398-109899420 AGATGCTGGGGCCATGCCCTTGG - Intergenic
912547519 1:110461580-110461602 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
913082321 1:115399990-115400012 ATATGCTGCTGCCTTGATCTTGG + Intergenic
914325502 1:146611531-146611553 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
915006164 1:152639007-152639029 AGATACTAGCACCATGCTCTTGG + Intergenic
915015695 1:152731100-152731122 AGATGCTGATGTTGTGCTCTTGG + Intergenic
915627550 1:157124853-157124875 AGCTGCTGTTGCCAAGCCCTGGG + Exonic
915766575 1:158368512-158368534 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
915826377 1:159082414-159082436 ATATGCTGGTACCTTGATCTTGG - Intronic
915852415 1:159339720-159339742 AGATGCCAGTGCCATTCTCATGG - Intergenic
916175473 1:162034460-162034482 AGATGTTGGTGCCATGCTCTTGG + Intergenic
916334048 1:163650169-163650191 ATCTGCTGGTGCCTTGATCTGGG - Intergenic
916403690 1:164475931-164475953 AAATGCTGATGCCATGCTAGAGG - Intergenic
916416587 1:164598007-164598029 AAATGCCAGAGCCATGCTCTGGG - Intronic
916539697 1:165740871-165740893 AGATGCCAGCACCATGCTCTTGG + Intronic
916565844 1:165976380-165976402 AGATGCTGGTGCTATGCTCTTGG - Intergenic
916655599 1:166872757-166872779 AGATGCTGGTGCCATGCTTTTGG + Intronic
916687427 1:167159981-167160003 AGATGCCAGTGCCATGCTCTTGG - Intergenic
916738017 1:167625236-167625258 AGATGTTAATGCTATGCTCTTGG + Intergenic
916747681 1:167697250-167697272 GGATCCTGGGGCCTTGCTCTTGG - Exonic
916899641 1:169207081-169207103 AGATGCTGGTACCATGCTTCTGG - Intronic
917116689 1:171610490-171610512 AAATGCTGGCACCATGCTCCTGG - Intergenic
917314274 1:173708482-173708504 CAATGCTGGTGCCTTGATCTGGG + Intergenic
917580300 1:176370353-176370375 AGATGCTGGTGCTTTGATCTTGG - Intergenic
917863369 1:179170094-179170116 AGATGTTGGTGCTATGCCCTTGG - Intronic
917926763 1:179795553-179795575 AGATGCTGGTGCCATGCTCTTGG + Intronic
918152996 1:181814679-181814701 CAATGCTGGTGCCTTGATCTTGG - Intergenic
918221212 1:182438508-182438530 AGATGCTGGTGCCATGCTCTTGG - Intergenic
918232995 1:182552718-182552740 AGATGTTAGTGTCATGCTCTTGG - Intronic
918491597 1:185087250-185087272 ATCTGCTGGTGCCATGATCTTGG - Intronic
918694671 1:187530367-187530389 AGATGCTGGTGCCATGCTCTTGG - Intergenic
918704538 1:187644038-187644060 AGATGCCAGTGCCATGTTCTTGG - Intergenic
918747991 1:188230852-188230874 AGATGCTGGTCCCTTGATCTTGG - Intergenic
918977892 1:191513902-191513924 ATATGCTGGTACCTTGTTCTTGG + Intergenic
919105556 1:193146423-193146445 AGATGCCACTGCTATGCTCTTGG - Intronic
919130398 1:193443197-193443219 AGATGCCAGTGCCATGCTCTTGG + Intergenic
919773611 1:201178895-201178917 AGATGTTGGTGCCATGCTGTTGG + Intergenic
920041055 1:203097626-203097648 AGATGCTGGTGCTATGCTCCTGG - Intronic
920303266 1:205002549-205002571 AGCTCCTGGTGCCTGGCTCTAGG + Intronic
920744199 1:208610676-208610698 AGATGCTGGTGTCTTTATCTTGG - Intergenic
920760652 1:208780898-208780920 ACCTGCTGGTGCCTTGCTCTTGG - Intergenic
920986438 1:210894785-210894807 AGATGCCAGCACCATGCTCTTGG + Intronic
921165115 1:212501395-212501417 AGATGGCAGTGCCATTCTCTTGG + Intergenic
921456279 1:215376002-215376024 AGGTGCTGGCACCATGCTCCAGG - Intergenic
921588637 1:216977991-216978013 AGATACTGGAACCATGCTCTTGG + Intronic
921805626 1:219450946-219450968 AGATGCCAGTGCCATGCCCTTGG + Intergenic
922015924 1:221646999-221647021 AGATGCTAGTGCCATGCTCTTGG - Intergenic
922060195 1:222081928-222081950 ATATGTTGGTGTCATGCTTTTGG - Intergenic
922063374 1:222112699-222112721 AGATGCTGCCACCATGCTCTTGG + Intergenic
922175521 1:223194185-223194207 AGATGCCAGTGCCATGCTCTTGG - Intergenic
922254015 1:223875831-223875853 AGATGCCGGTGCCTTGACCTTGG + Intergenic
922332588 1:224590518-224590540 AGATGCTGGTGCTATGCTCTGGG - Intronic
922386275 1:225087184-225087206 AGATGCCAGCCCCATGCTCTTGG - Intronic
922396387 1:225205397-225205419 ATCTGCTAGTGCCATGATCTTGG + Intronic
922506559 1:226129424-226129446 AGATGCTGGTGCCATGCTCTTGG + Intergenic
922562819 1:226581447-226581469 AGATGCTGGCACAATACTCTTGG - Intronic
922715785 1:227870729-227870751 GGATGCTGGTGCCTTGATCTTGG + Intergenic
922823625 1:228502038-228502060 ATATGCTGGTGGCTTGATCTTGG + Intergenic
922914753 1:229248040-229248062 ACATGCTGGTGCCTTGATCTTGG - Intergenic
922995229 1:229952036-229952058 AGATGTTGGTGCCATGCTTTTGG + Intergenic
923416866 1:233770900-233770922 AGATGCTGGTAACTTGATCTTGG + Intergenic
923676848 1:236087830-236087852 AGATGCTGATGCCTTGACCTTGG - Intergenic
924122913 1:240820731-240820753 ATCTGCTGGTGCCTTGATCTTGG + Intronic
924415602 1:243853081-243853103 ATCTGCTGGTGCCATGATCTTGG - Intergenic
924584304 1:245348463-245348485 AGTTGCTGGTGCCTTGGTCTTGG - Intronic
924650848 1:245926012-245926034 AGATGCCGGTGCCATGCTTTTGG - Intronic
1062880228 10:972374-972396 AGATGCTGGCACCATGCTCTTGG + Intergenic
1063021478 10:2133264-2133286 AGATATTGGAGCCATGCTCATGG + Intergenic
1063027675 10:2197864-2197886 AGATGCTGGTGCCATGCTGTTGG + Intergenic
1063041115 10:2338278-2338300 ACCTGCAGGTGCCTTGCTCTTGG - Intergenic
1063541114 10:6934742-6934764 AGATGCTGATGCCATGCTTCCGG + Intergenic
1063802937 10:9602266-9602288 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1063998070 10:11640005-11640027 TGATGCTGCTGCCCTGATCTGGG - Intergenic
1064319726 10:14293336-14293358 AGATGCCGGTGCCATGCTCTTGG + Intronic
1064328207 10:14370478-14370500 ACATGCTGTTGCCTTGATCTTGG + Intronic
1064909590 10:20385282-20385304 AGATGCCAGTGCCTTGATCTGGG + Intergenic
1065498616 10:26355761-26355783 ACCTGCTGGTGCTATGATCTTGG - Intergenic
1065742979 10:28813748-28813770 AAATGCTGGCACCATGCTCTTGG - Intergenic
1065966823 10:30777479-30777501 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1065989594 10:30994578-30994600 AGAGGCTCGCACCATGCTCTTGG + Intronic
1066020093 10:31289795-31289817 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1066043555 10:31577413-31577435 AGATGCCGGCACCATGCTCTTGG + Intergenic
1066132407 10:32407344-32407366 AGATGCCAGTACCATACTCTTGG + Intergenic
1066133544 10:32418642-32418664 GGATGCTGGTCCCATGCACTTGG - Intergenic
1066475149 10:35739487-35739509 ATCTGCTGGTGCCTTGGTCTTGG - Intergenic
1066479455 10:35781451-35781473 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1066533689 10:36367058-36367080 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1066667900 10:37804035-37804057 AGCTGCTGGTTACATGATCTTGG + Intronic
1067204647 10:44202419-44202441 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1067221927 10:44350430-44350452 AGATGCTGGCACCATGCTCTTGG - Intergenic
1067306252 10:45066891-45066913 AGATGCCAGTGCCATGCTCCCGG - Intergenic
1067428319 10:46225815-46225837 GGAAGCTGGGGACATGCTCTAGG + Intergenic
1067465313 10:46493951-46493973 AGATGCTGGTGCCATGCTCTTGG - Intergenic
1067621874 10:47890650-47890672 AGATGCTGGTGCCATGCTCTTGG + Intergenic
1067707027 10:48614024-48614046 AGATGCTGGTGCCATGCTCTTGG + Intronic
1067739790 10:48886606-48886628 AGATGCCAGTGCCATGCTCTGGG + Intronic
1067782019 10:49214687-49214709 ACCTGCTGGTGCCTTGATCTGGG - Intergenic
1068154947 10:53186646-53186668 AGATGACAGTACCATGCTCTTGG + Intergenic
1068248881 10:54409910-54409932 AGATGCCGATGCCATACTCTTGG + Intronic
1068464742 10:57375443-57375465 AGATGCTGGCACAATGATCTTGG - Intergenic
1068697204 10:59980246-59980268 AGAGGCTAGTGCCTTGATCTTGG + Intergenic
1069134136 10:64742997-64743019 ATATGCTGCTGCCATGACCTTGG + Intergenic
1069747538 10:70725482-70725504 ATCTGCTGGTGCCCTGATCTTGG - Intronic
1069763965 10:70837845-70837867 AGATATCAGTGCCATGCTCTTGG - Intronic
1069764260 10:70841417-70841439 ATCTGCTGTTGCCTTGCTCTTGG - Intronic
1070010612 10:72470453-72470475 AGATATTGGTGCCATGCTCTTGG - Intronic
1070020377 10:72579272-72579294 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1070203881 10:74235972-74235994 AGAAGCTGGCACCATACTCTAGG + Intronic
1070635513 10:78123602-78123624 AGACACTGGCACCATGCTCTTGG - Intergenic
1070872420 10:79768321-79768343 ACTTGCTGGTGCCTTGATCTTGG - Intergenic
1071177691 10:82945506-82945528 AGATGCTGGCGCTATGCTTTTGG - Intronic
1071279806 10:84090709-84090731 ATCTGCTGGTGTCATGATCTTGG - Intergenic
1071302702 10:84268386-84268408 AGATGCTGCTGCCTTGAACTAGG + Intergenic
1071639341 10:87290473-87290495 ACTTGCTGGTGCCTTGATCTTGG - Intergenic
1071655896 10:87447476-87447498 ACTTGCTGGTGCCTTGATCTTGG + Intergenic
1071696969 10:87886855-87886877 AGATGCTGATGCCATGCTCTTGG + Intronic
1071787446 10:88917835-88917857 CAATGCTGGTGCCTTGATCTTGG - Intronic
1071921989 10:90360664-90360686 AACTGCTGGTGCCTTGATCTTGG + Intergenic
1071992386 10:91112610-91112632 AGATGCTGGTGTCTTGATCTTGG - Intergenic
1072018694 10:91377160-91377182 AGATGCTAGTGCCATGCTCTTGG + Intergenic
1072123347 10:92423484-92423506 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1072396316 10:95046335-95046357 AGAAGCCAGTGCCATGCTCTTGG - Intronic
1072465434 10:95657953-95657975 AGATGCTGGCACCTTGATCTTGG + Intergenic
1072568510 10:96638323-96638345 AGATGCCAGCACCATGCTCTTGG + Intronic
1072611784 10:97022001-97022023 AGCTGTTGGGGCCATGCTGTTGG + Intronic
1072642385 10:97221684-97221706 ATCTGCTGGCACCATGCTCTTGG + Intronic
1073026618 10:100491975-100491997 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1073629504 10:105134441-105134463 ACATGCTGGTGCCTTAATCTTGG - Intronic
1073879357 10:107961971-107961993 AGATGCCAGTGCCACGCTCTTGG - Intergenic
1073916612 10:108412129-108412151 AGATGCCAGTGCCTTGATCTTGG + Intergenic
1073982252 10:109168031-109168053 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1074009124 10:109458623-109458645 AGATGCTGGTGCCATGCTCTTGG - Intergenic
1074146236 10:110719937-110719959 ATTTGCTGGTGCCTTGATCTTGG - Intronic
1074258528 10:111828481-111828503 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1074461902 10:113645971-113645993 AGTTGATGTTTCCATGCTCTGGG + Intronic
1074548217 10:114418618-114418640 AGATGCCAGTGCCAGGCTCTTGG + Intergenic
1074754515 10:116614572-116614594 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1074827644 10:117226141-117226163 AGATGCTGGAGCCATGATCTGGG + Intergenic
1074836480 10:117300856-117300878 ATCTGCTGGTGCCCTGATCTTGG + Intronic
1074969741 10:118526258-118526280 TGATGCTGGTGCCATGCTCTTGG + Intergenic
1075067291 10:119297748-119297770 AGATGCTGAAGTCATGCTCTTGG + Intronic
1075156835 10:119984813-119984835 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1075183348 10:120232314-120232336 AGATGCCGGTGCTTTGATCTTGG + Intergenic
1075360726 10:121830467-121830489 AGATGCAAGTGCCATGCCCTTGG + Intronic
1075395941 10:122127100-122127122 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1075399699 10:122151995-122152017 AAATGCTGGTGCCAAGCCCCAGG - Intronic
1075499951 10:122964419-122964441 AGATGCTGGTGCCATGCTCTTGG + Intronic
1075535342 10:123266827-123266849 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1075620120 10:123920926-123920948 AGATGCTGGTGCCCTATTCTTGG + Intronic
1076104430 10:127809420-127809442 AGATACTGGTGCCATGCCCTCGG + Intergenic
1076341832 10:129754664-129754686 AGATGCCGGCGTCATGCTCTTGG - Intronic
1076425876 10:130367245-130367267 AGATGCGGGTGCCTTGATCTTGG + Intergenic
1077352154 11:2097995-2098017 AGATGCTGGAGGCATGTCCTGGG - Intergenic
1077365592 11:2160270-2160292 AGATGCTGGGGACAGGCCCTGGG - Intronic
1077931120 11:6734109-6734131 AGATGCTGGTGGCTTTATCTTGG + Intergenic
1077956607 11:7027329-7027351 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1078087109 11:8240551-8240573 ATCTGTTGGTGCCTTGCTCTCGG - Intronic
1078194471 11:9123995-9124017 ATTTGCTGGTGCCTTGATCTTGG + Intronic
1078352235 11:10603879-10603901 CCATGCTGGTGCCCTGATCTTGG + Intronic
1078424130 11:11235521-11235543 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1078477615 11:11645115-11645137 AGATGCTAGTGCCATGCTCTTGG - Intergenic
1078734742 11:14009714-14009736 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1078756593 11:14216572-14216594 AGATACTGGCACCATGCTCTTGG - Intronic
1078931646 11:15916742-15916764 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1078964767 11:16325987-16326009 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1079551275 11:21701503-21701525 AGATGCTAGTGACTTGATCTTGG + Intergenic
1079590421 11:22176593-22176615 AGATGCCTATGCCATACTCTTGG - Intergenic
1079592439 11:22196182-22196204 AGATGCCAATACCATGCTCTTGG - Intronic
1079663967 11:23080536-23080558 AGATGCCAGCACCATGCTCTTGG - Intergenic
1080029151 11:27642738-27642760 ACCTGCTGGTGCCATGATCTTGG + Intergenic
1080205624 11:29725674-29725696 ACATGCTGGTGCCTTGATTTTGG + Intergenic
1080319971 11:30996692-30996714 ACATGCTGGTGCCTTGATCTTGG + Intronic
1080375499 11:31705177-31705199 AGATGTTGGCACCATGCTCTTGG - Intronic
1080564236 11:33493355-33493377 AGATGCTGGCACCTTGATCTTGG + Intergenic
1080577202 11:33610844-33610866 AGATGCTGGCACCTTGATCTTGG - Intronic
1080630815 11:34073919-34073941 AGATGCTGGTACCTTGATCTTGG - Intronic
1080695045 11:34596134-34596156 ATCTGCTGGTGCCTTGCTCTTGG + Intergenic
1080695128 11:34596921-34596943 AGCTGCTGGAGGCATGCTCAGGG + Intergenic
1080942366 11:36933897-36933919 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1081373065 11:42327577-42327599 ACATGCTGGCGCCATGCTCTTGG + Intergenic
1081395670 11:42583350-42583372 AGATGCTGGAGCCATGATCTTGG - Intergenic
1081429725 11:42963192-42963214 AGATGACAGTGCCATGCTCTTGG - Intergenic
1081445582 11:43128824-43128846 AGATGCTAATGCCTTGATCTTGG + Intergenic
1082065559 11:47896649-47896671 AGATCCTGGCACCATGCTCTTGG - Intergenic
1082114413 11:48312682-48312704 AGATGCTGGCACTATGCTTTTGG + Intergenic
1082882928 11:58055905-58055927 GCATGCTGGTGCCTTGATCTTGG + Exonic
1083140542 11:60717790-60717812 AGATACTGGCACCATGCTCTTGG + Intergenic
1083263582 11:61535997-61536019 TGGTGCTGGTGCCAAGCTTTGGG + Intronic
1083357441 11:62077329-62077351 ATCTGCTGATGCCATGTTCTTGG - Intergenic
1083447635 11:62719897-62719919 AGATGCTAATGCTATGCTCTTGG + Intronic
1083513874 11:63237500-63237522 AGATGCTGATGCCAAACTCTTGG + Intronic
1083523847 11:63342388-63342410 AGATGCTGGCGCCATGCTCTTGG - Intronic
1083538436 11:63492636-63492658 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1084126337 11:67101562-67101584 AGATGCCAGTGCCTTGATCTTGG - Intergenic
1084779481 11:71399030-71399052 AGATGCTCTAGCCAAGCTCTGGG - Intergenic
1085007170 11:73102759-73102781 AGATGCTGGTGCCTTGATTTTGG + Intronic
1085523446 11:77151257-77151279 AGAGGCTGGAGCCCTGATCTGGG + Intronic
1085544889 11:77309195-77309217 AGATGCTGGTGCCATGCTTCTGG - Intergenic
1085757891 11:79216740-79216762 AGATGCCAGCACCATGCTCTTGG + Intronic
1085846467 11:80071468-80071490 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1086059505 11:82685797-82685819 AATTGCTGGTGCCTTGGTCTGGG - Intergenic
1086191407 11:84083705-84083727 AGATGCTGGTACCATGCTCTTGG + Intronic
1086265262 11:84990496-84990518 ATCTGCTGATACCATGCTCTTGG + Intronic
1086381960 11:86263738-86263760 AGATGCCGGCACCATGTTCTTGG - Intronic
1086530133 11:87775092-87775114 AGATGCCAGTGCCATGCTCTTGG - Intergenic
1086530271 11:87777136-87777158 AGATGCCAGTGCTATGTTCTTGG - Intergenic
1086532828 11:87806299-87806321 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1086593558 11:88544143-88544165 AGATGCTGGTGCCATGGTCTTGG + Intronic
1086942616 11:92814093-92814115 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1086966631 11:93034731-93034753 AGATGCCAGTGCCATGCTCTAGG - Intergenic
1086972462 11:93098305-93098327 AGATGCCGGCACCATGCTCTTGG + Intergenic
1087004024 11:93451038-93451060 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1087022118 11:93614262-93614284 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1087659812 11:100974064-100974086 AGAAGATGCTGCCATGCTGTTGG - Intronic
1088252902 11:107877127-107877149 ACCTGCTGGTGCCTTGATCTTGG - Intronic
1088338561 11:108736756-108736778 AAATGCTGGTGCCCTGGTCTTGG + Intronic
1088499076 11:110464344-110464366 AGATGCTGGTACCATGCTCTTGG - Exonic
1088571556 11:111228336-111228358 AAATGCTGGTGCCTTGATTTTGG - Intergenic
1088934656 11:114387500-114387522 AGATGTTGGCATCATGCTCTTGG + Intergenic
1088979168 11:114846223-114846245 ACATGCTGGTGTCATTCTCAGGG + Intergenic
1089648385 11:119895191-119895213 AGGGGCTGGTGCCCAGCTCTGGG - Intergenic
1089883724 11:121799624-121799646 AGATGCTAGTGCCATGCTCTTGG - Intergenic
1090066468 11:123508193-123508215 AGATGCTGGTGTTATGCTTTTGG - Intergenic
1090102807 11:123818720-123818742 AGATGCCAATCCCATGCTCTTGG - Intergenic
1090374466 11:126279207-126279229 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1090762687 11:129851088-129851110 AGATGCTGCTGCCTTGATCTTGG - Intronic
1090898889 11:131007519-131007541 AGAGACTGGTGCAATGATCTGGG - Intergenic
1091088045 11:132742520-132742542 ATATGCTGGCACCATGATCTTGG + Intronic
1091130027 11:133138258-133138280 AGATGCCAGTGCCATATTCTTGG + Intronic
1091287325 11:134414874-134414896 ACATGCTGGTGCTAGGCTTTGGG - Intergenic
1091451433 12:574648-574670 AGATGCCAGTGCAATGTTCTTGG + Intronic
1091612323 12:2021728-2021750 AGATGCTGGCGCCTAGATCTTGG - Intronic
1091845213 12:3650605-3650627 AGATCCTGGTGCTGTGCTTTAGG + Intronic
1092242517 12:6843891-6843913 TGATGCCAGTGCCAAGCTCTGGG + Exonic
1092395100 12:8118979-8119001 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1092455750 12:8641298-8641320 AGATGATGGCACCATGTTCTTGG - Intronic
1092646428 12:10578959-10578981 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1092724674 12:11473816-11473838 AGATGCTGGTGCCATGCCTCTGG + Intronic
1092775507 12:11941884-11941906 AGATGCCAGTGCTGTGCTCTTGG + Intergenic
1092882147 12:12895533-12895555 AGATGGTAGTGCCATTCTCAGGG + Intronic
1093083376 12:14839464-14839486 AGATGCTGGAGCCATGCTCTTGG - Intronic
1093214140 12:16343337-16343359 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1093699338 12:22201297-22201319 AAATGCTGGTGAAATGCTGTTGG - Exonic
1093722779 12:22463547-22463569 AGATGCTGGTTCCTTGATATGGG + Intronic
1093903727 12:24664676-24664698 AGATGCTGGTCCCTTGATCTTGG + Intergenic
1094045655 12:26163497-26163519 AGATGCTGGCACCTTGATCTTGG - Intronic
1094394085 12:29986210-29986232 AGATGCCAGTCCTATGCTCTTGG - Intergenic
1094470953 12:30800550-30800572 AGACGCCAGTGCCATGTTCTTGG + Intergenic
1094741365 12:33293050-33293072 AGATGCTGGTATCATGCTCTTGG - Intergenic
1094775495 12:33722541-33722563 AGATGCTGTCACCATGTTCTTGG - Intergenic
1094802940 12:34058706-34058728 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1095127025 12:38491943-38491965 AGCTACTGGTGCCTTGTTCTTGG - Intergenic
1095408474 12:41894622-41894644 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1095735337 12:45549701-45549723 AGGTGCTGGTGCCTTGATCTTGG + Intergenic
1096896190 12:54822402-54822424 AGAGGCTAGTGCCATGCTCTTGG + Intergenic
1097136630 12:56862475-56862497 AGATGACAGTGCCATGCTCTTGG + Intergenic
1097358122 12:58625388-58625410 AGATGCTGGTGCCAAGCTCTTGG - Intronic
1097443289 12:59637961-59637983 AGATGCCAGCACCATGCTCTTGG + Intronic
1097539391 12:60919013-60919035 AGATACTGGTGCCTTTATCTTGG - Intergenic
1097689739 12:62723621-62723643 AGATGCTAGTGTCTTGATCTTGG + Intronic
1097923748 12:65105482-65105504 AGATGCTAGTGCCATGCCCTTGG - Intronic
1098335947 12:69404594-69404616 AGATGCCAGTGCCATACCCTGGG + Intergenic
1098425578 12:70362346-70362368 AGATACTACTGTCATGCTCTTGG + Intergenic
1098507546 12:71271647-71271669 ATCTGCTGGTGCCATGATCTTGG - Intronic
1098817463 12:75185566-75185588 AGATGCTGGCACCATGATCTTGG + Intronic
1099427214 12:82538084-82538106 AGATGCTGGCACCATGATATTGG + Intergenic
1099807774 12:87542198-87542220 AGATGCCGGTGGCATGCTTTTGG + Intergenic
1099925212 12:89008805-89008827 ATATGCTGGCGCCTTGATCTTGG - Intergenic
1099998355 12:89804768-89804790 AGATGCCAGAGCCATGCTGTTGG + Intergenic
1100007486 12:89911572-89911594 AGATGCTGGTGCCATTCTCTTGG - Intergenic
1100343951 12:93708881-93708903 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1100455519 12:94747992-94748014 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1100596444 12:96076500-96076522 AAATGCTGGAGCCTTGATCTTGG - Intergenic
1100779697 12:98010761-98010783 AGCTGCTGGTGCCTTGATCTTGG + Intergenic
1100927539 12:99566738-99566760 AGATGACGGCACCATGCTCTTGG + Intronic
1101132810 12:101706605-101706627 TGATGCCAGTGCCATGCTCTTGG + Intronic
1101634348 12:106525544-106525566 AAATGCTGGTGCCTTGATCTTGG + Intronic
1101752862 12:107597384-107597406 AGATGCTGGTGCTACACTCTTGG - Intronic
1101853420 12:108422737-108422759 AGATGCTGGTGCCATGCTTTTGG - Intergenic
1102558416 12:113744723-113744745 AGATGCTGGCACCTTGCTATTGG - Intergenic
1103093554 12:118115028-118115050 AGATGCTTGTTCCATGCTCTTGG + Intronic
1103171572 12:118824995-118825017 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1103279346 12:119742562-119742584 AGATGCTGGTGCCGCATTCTCGG - Intronic
1103448347 12:121009665-121009687 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1103866677 12:124057839-124057861 AGCTGCTGGTGCCTTGAGCTTGG - Intronic
1104695616 12:130861397-130861419 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1105016392 12:132788486-132788508 AGATGCTGGTGACAGTTTCTCGG - Intronic
1105073528 12:133253324-133253346 ACATGCTGGCACCATGCTTTTGG - Intergenic
1105489552 13:20874645-20874667 AGATGCCGGCACCATGCTCTTGG + Intronic
1105500162 13:20964822-20964844 AGATGCTGGCACCTTGATCTTGG + Intergenic
1105624553 13:22100322-22100344 AGATGCTGGCACCATGCTCTTGG + Intergenic
1105827367 13:24134355-24134377 AGATTCTGGTGCGCTGCTCAGGG + Intronic
1106394953 13:29370635-29370657 AGATGCCAGTGCTATGCTCTTGG + Intronic
1106521317 13:30500218-30500240 AGAAGCTGCTGCCATGTTCTTGG + Intronic
1106567604 13:30899939-30899961 AGATGCTGGCACCTTGATCTTGG - Intergenic
1106572346 13:30938411-30938433 CAATGCCAGTGCCATGCTCTTGG - Intronic
1106651911 13:31700481-31700503 AGATGTTGGCACCATGCTCTTGG - Intergenic
1106945107 13:34818833-34818855 AGATGCTGGAGCCTTGATCTTGG - Intergenic
1107019501 13:35737076-35737098 AGATGGTGGTGGCTTGCCCTAGG - Intergenic
1107354389 13:39551226-39551248 AGATGCCAGCACCATGCTCTTGG - Intronic
1107421337 13:40249704-40249726 AGATGCCAGCACCATGCTCTTGG - Intergenic
1107543784 13:41417708-41417730 GGATGCTGGTGCCTTGCTCTTGG + Intergenic
1107734049 13:43377344-43377366 AGATGCTGGCACCATGCCCTTGG + Intronic
1108005626 13:45943135-45943157 AGATGTTGGCACCATGCTCCTGG + Intergenic
1108112407 13:47089839-47089861 AGATGCTGGTGCCATGTGCTTGG - Intergenic
1108161472 13:47644764-47644786 AGATGCTGGTGCCTTGATCTTGG + Intergenic
1108249323 13:48549313-48549335 AGATGCTTGTGCCCTGATTTTGG + Intergenic
1108269424 13:48744646-48744668 AAATGCCAGTGCCATGTTCTGGG + Intergenic
1109009728 13:56925217-56925239 AGATGCTGGTGCCATTCTCTTGG + Intergenic
1109057360 13:57567908-57567930 ACATGCTGATGCCATGCTCTTGG + Intergenic
1109165782 13:59032905-59032927 AGAAGCTGCTGCCATGTCCTTGG + Intergenic
1109330216 13:60919823-60919845 AGATGCTGGTACCTTGATCTTGG - Intergenic
1109332728 13:60949980-60950002 AGATGCTGGTGCGGTGCTCTTGG + Intergenic
1109588729 13:64446878-64446900 AGATGCTGGTGTTGTGATCTTGG - Intergenic
1109732661 13:66436342-66436364 AGATGATGGTGCCTTGATCTTGG + Intronic
1109758074 13:66788144-66788166 AGATGCTGGTGGCTTGATCTTGG - Intronic
1109803444 13:67405548-67405570 ACAGTCTGGTGCCATGCCCTGGG + Intergenic
1109869523 13:68315337-68315359 AGATGCTTGCACTATGCTCTTGG - Intergenic
1110084962 13:71365890-71365912 AGATGCTGGCACCGTGCTCTTGG - Intergenic
1110159326 13:72357025-72357047 AGATGCTGGTGCCTTGATCTTGG - Intergenic
1110187385 13:72691315-72691337 AGATGCTGGTGCCATGGTATTGG + Intergenic
1110251998 13:73390687-73390709 AGATGCTGGTGCCATGCTCTTGG + Intergenic
1110315950 13:74107024-74107046 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1110468597 13:75831563-75831585 AGATGTTGGTGCCATGCTCTTGG - Intronic
1110666598 13:78124774-78124796 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1110707532 13:78612198-78612220 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1110913879 13:80997966-80997988 TGATGCTGGCACCATGCTCTTGG + Intergenic
1111117648 13:83801855-83801877 ATCTGCTGGTGCCATGGTTTTGG + Intergenic
1111360310 13:87167407-87167429 AGGTGCTGGCACCATGCTCTTGG + Intergenic
1111432582 13:88162938-88162960 AGATGCTGGCACCATGCTCTTGG - Intergenic
1111432803 13:88164950-88164972 AGATGCTGGTGCCATGTTCTTGG - Intergenic
1111513461 13:89296800-89296822 AGATGCTGGCACCATGACCTTGG + Intergenic
1111811813 13:93100583-93100605 AGATGCCAGTGCCACGTTCTTGG + Intergenic
1112074700 13:95898811-95898833 AGATGCCAGTGCCTTGATCTTGG + Intronic
1112262111 13:97886429-97886451 GAATGCTGGTGCCTTGATCTTGG - Intergenic
1112334503 13:98502708-98502730 AGATGCCAGTACCATGTTCTTGG + Intronic
1113173957 13:107539226-107539248 AGATGCTGATGCCATGATTTTGG - Intronic
1113321286 13:109234934-109234956 ACCTGCTGGTGCCTTGATCTGGG + Intergenic
1113391100 13:109897895-109897917 AGATGCTGGCACCATGCTCTTGG + Intergenic
1113491947 13:110699134-110699156 AGATGCTGGCACCTTGATCTTGG + Intronic
1113615261 13:111676080-111676102 GGATCCTGGGGCCATCCTCTTGG - Intergenic
1113620728 13:111760993-111761015 GGATCCTGGGGCCATCCTCTTGG - Intergenic
1114127563 14:19747685-19747707 AGATGCTCTTGCCCTGCTGTAGG - Exonic
1114187871 14:20416775-20416797 AAATGCTAGTGCCTTGATCTTGG + Intergenic
1114707848 14:24745526-24745548 AGATGCTGACACCATGCTCTTGG - Intergenic
1114748754 14:25180398-25180420 AGATGCTAGTTCTATGTTCTTGG - Intergenic
1114774852 14:25469829-25469851 AGATGCCAGCACCATGCTCTTGG + Intergenic
1114857500 14:26466889-26466911 AGATGCCAGTGCCTTGATCTTGG + Intronic
1114889576 14:26901135-26901157 AGATGTGAGTGCCTTGCTCTTGG + Intergenic
1115293784 14:31802624-31802646 AGAAGTTGCTGCCATGCCCTTGG + Intronic
1115503319 14:34068480-34068502 ATCTGCTGGTGTCATGATCTTGG - Intronic
1115655988 14:35444291-35444313 AGATGCTGACACCATGTTCTTGG - Intergenic
1115658417 14:35466269-35466291 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1115840957 14:37469842-37469864 AGATGCCAGTGCCATGCTCTTGG + Intronic
1115863654 14:37718011-37718033 AGATGCTAGTGCCTCGATCTTGG + Intronic
1116071331 14:40049194-40049216 AGATGTCAGTGCCATGGTCTTGG + Intergenic
1116416241 14:44681227-44681249 AGATGCCAGTGTCATGCTCTTGG - Intergenic
1116439662 14:44937741-44937763 AGATGCTAGCACCATGTTCTTGG - Intronic
1116439967 14:44940039-44940061 AGATGCAGGCATCATGCTCTTGG - Intronic
1116676144 14:47908320-47908342 AGATGCCAGCGCCATGCTCTTGG - Intergenic
1116981801 14:51179255-51179277 AGAGGCTGGTGCCTTAATCTTGG - Intergenic
1117030452 14:51663807-51663829 AGATGCTGGTGCCGTGCTCTTGG - Intronic
1117143511 14:52813156-52813178 AGATGCCAATGCCATGTTCTTGG + Intergenic
1117177878 14:53163917-53163939 AAATGCTGGTATTATGCTCTTGG - Intergenic
1117286948 14:54294984-54295006 AGATGCTAGCACCATGTTCTTGG - Intergenic
1117670794 14:58103434-58103456 AGATGCTGGTACCTTGGTCTTGG + Intronic
1117684894 14:58242664-58242686 AGATGTCAGTGCCATGCTCTTGG - Intronic
1117732072 14:58733158-58733180 AGATGCTGGCACCTTGATCTTGG - Intergenic
1117851941 14:59982444-59982466 AGATGCAGGCACCATGCTCTTGG - Intronic
1117962111 14:61173612-61173634 AGATGCTGATACCATGTTTTTGG + Intergenic
1117966194 14:61209177-61209199 AGATACCGGTGCTATGCTCTTGG + Intronic
1118033317 14:61839332-61839354 AGATGCTGGTACCTTGATCTTGG + Intergenic
1118129452 14:62946109-62946131 AGATGATGGTGACTTGGTCTTGG + Intronic
1118340206 14:64889540-64889562 ACATGTTGGTGCCATAATCTTGG - Intergenic
1118407949 14:65445333-65445355 AGATGCTGGCGCCTTGATCTTGG + Intronic
1118437841 14:65787663-65787685 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1118815551 14:69311160-69311182 ACCTGCTGGTGCCTTGATCTTGG - Intronic
1118825308 14:69374795-69374817 AGGTGCCAGTGCCATGCTCTTGG - Intergenic
1118996398 14:70840486-70840508 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1119041116 14:71275521-71275543 AGATGCTGGCACCATGCCCTTGG - Intergenic
1119131930 14:72180879-72180901 AGATGCCTGTGCCATGCTCTTGG + Intronic
1119151882 14:72368134-72368156 AGATGCTGGCACCATGCTTTTGG - Intronic
1119256084 14:73198596-73198618 AGATGATATTGCCATGATCTAGG + Intronic
1119298026 14:73549077-73549099 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1119508696 14:75194398-75194420 AGAGGCTGGGGCCATGCTCTTGG + Intergenic
1119556482 14:75557376-75557398 AGATACTGGTGCCATGCTCTTGG - Intergenic
1119556610 14:75558284-75558306 AGATGCTGGCGCCATGCTCTTGG - Intergenic
1119620693 14:76129961-76129983 AGATGCTGATGCCTTGATCTGGG - Intergenic
1119630359 14:76226730-76226752 AGATTCTGATGCCTTGATCTTGG + Intronic
1119784122 14:77299816-77299838 AGATGCAGGTGCCTTGTCCTTGG - Intronic
1119863351 14:77953182-77953204 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1119911459 14:78353363-78353385 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1120133455 14:80835211-80835233 AGATGCTAGAGCCATGCTTCTGG + Intronic
1120257485 14:82139398-82139420 AGATACTGGGACCATGTTCTTGG - Intergenic
1120383312 14:83810705-83810727 AGATGCTGATGCTATGCTGCTGG - Intergenic
1120398241 14:83995481-83995503 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1120427839 14:84373246-84373268 AGATGCCATTGCCATGCTCTTGG - Intergenic
1120477711 14:85009035-85009057 ACCTGCTGGTGCCTTGGTCTTGG - Intergenic
1120600813 14:86505990-86506012 AGATGTTGGTGTCATCATCTTGG - Intergenic
1120842182 14:89095634-89095656 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1120932395 14:89861830-89861852 AGATGCTGGTACCATGTTCTTGG + Intronic
1121097987 14:91231208-91231230 AGATGCTGGCACCATGCTCTTGG - Intergenic
1121178571 14:91909704-91909726 AGATGCTGGCACCATGCATTAGG + Intronic
1121315580 14:92959246-92959268 AGCTGCTGGTGCCAGGGTCATGG + Intronic
1121420600 14:93810741-93810763 AGATGCTGATGCCTTGATCTTGG + Intergenic
1121703222 14:95972015-95972037 AGATGCTGATGTTATGCTTTTGG + Intergenic
1121789972 14:96691780-96691802 AGATGTAGGTGCCCTGATCTTGG - Intergenic
1121820508 14:96962069-96962091 GGATGCCAGTGACATGCTCTTGG + Intergenic
1121820653 14:96963258-96963280 AGATGCCAGTGACATGCTCTTGG + Intergenic
1122285548 14:100649843-100649865 AGATGCTGGCGCCATGCTGTTGG + Intergenic
1122320471 14:100852337-100852359 AAATGCTGTTGCCATCCACTCGG - Intergenic
1123571014 15:21609358-21609380 AGATGCTCTTGCCCTGCTGTAGG - Intergenic
1123607126 15:22044715-22044737 AGATGCTCTTGCCCTGCTGTAGG - Intergenic
1123978726 15:25578770-25578792 AGATGCTGCTGCCATGCCCTTGG + Intergenic
1124063362 15:26316824-26316846 AGATGCTGGTGCCATGCTCTTGG - Intergenic
1124150303 15:27171923-27171945 AGATGCCAGCACCATGCTCTTGG - Intronic
1124361199 15:29037750-29037772 AGATGCTGGCACCATGCTCTTGG - Intronic
1124381449 15:29170948-29170970 AGATGCTGGCCCCATGCTCTAGG - Intronic
1124794556 15:32764271-32764293 AGATGCTGGCACCATGATATTGG + Intergenic
1124949511 15:34303810-34303832 AGATGCTGGCACCTTGGTCTTGG + Intronic
1125136186 15:36345925-36345947 AGATGCTGGCACCTTGATCTTGG + Intergenic
1125697404 15:41651007-41651029 AGATCCCAGTGCCATACTCTTGG - Intronic
1125814014 15:42568310-42568332 AGATGCTGGCACCATGTTCTTGG - Exonic
1125910896 15:43437918-43437940 AGATGCTAGTGCCATGTCCTTGG - Intronic
1125987383 15:44067512-44067534 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1126064091 15:44811796-44811818 AGATCCTTGTGTCAAGCTCTTGG + Intergenic
1126656406 15:50982196-50982218 AGATGCCAGTGCCATGCTCTTGG + Intronic
1126853377 15:52813037-52813059 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1126882705 15:53116416-53116438 AGATGCCAGTGCCTTGATCTTGG + Intergenic
1126889802 15:53192610-53192632 TCATACTGGTGCCATGCTCTTGG - Intergenic
1127224484 15:56916068-56916090 AGATGCCAGTGCCATGCTCTTGG + Intronic
1127311292 15:57754219-57754241 ACATGCTGGTGCCTGGATCTTGG + Intronic
1127331625 15:57945391-57945413 AGATGCCAGTACCATGCCCTTGG + Intergenic
1127346216 15:58102409-58102431 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1127733239 15:61819140-61819162 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1127890230 15:63243846-63243868 AGATGCTGATGCCATACCCTTGG - Intronic
1128094190 15:64941392-64941414 AGATGCTGGTACCATGCTCTAGG - Intronic
1128538317 15:68507197-68507219 AGATGCCTGTGCCATGCTCTTGG - Intergenic
1128550158 15:68592997-68593019 AGATGCTGGTGCAATGCTCTTGG - Intronic
1128977799 15:72166230-72166252 AGATGCTTTTGCCCAGCTCTAGG + Intronic
1129118587 15:73380865-73380887 AGATGCTAGTGCCATGCTCTTGG - Intergenic
1129225124 15:74165052-74165074 ACCTGCTGGTGCCTTGCTCTTGG + Intergenic
1129746644 15:78026460-78026482 AGATGCCAGTGCCATGCTTTTGG + Intronic
1129827576 15:78644513-78644535 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1129872251 15:78947980-78948002 CTATTCTGGTGCCATGCTCAGGG - Intronic
1130359788 15:83172290-83172312 AGATGCCAGTGCCTTCCTCTTGG + Intronic
1130399308 15:83534228-83534250 AGATGCTGGTGCCATGCTGTTGG + Intronic
1130555479 15:84919527-84919549 AGATGTCAGTGCCATGCTCTTGG - Intronic
1130820915 15:87494884-87494906 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1130921135 15:88345615-88345637 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1130928812 15:88405755-88405777 AGATGCTGATGCCTTGATCTTGG - Intergenic
1131278088 15:90999173-90999195 AGACGTGAGTGCCATGCTCTTGG + Intronic
1131409498 15:92195009-92195031 ATCTGCTGGTGCCCTGATCTTGG + Intergenic
1131436104 15:92423539-92423561 CCCTGCTGGTGCCTTGCTCTTGG - Intronic
1131528637 15:93173217-93173239 AGATACCAGTACCATGCTCTTGG - Intergenic
1131533212 15:93212336-93212358 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1131634877 15:94221746-94221768 AGATGCTGCTGCTTTGCTTTTGG + Intergenic
1131862055 15:96664163-96664185 AGATGCTGGTGCCATGCTCTTGG + Intergenic
1131894697 15:97013670-97013692 ATATGCTGGTGCCTTAATCTTGG - Intergenic
1131929880 15:97429831-97429853 AGATGCTGGCGCTATGCTTCTGG + Intergenic
1202979366 15_KI270727v1_random:336482-336504 AGATGCTCTTGCCCTGCTGTAGG - Intergenic
1133175465 16:4010959-4010981 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1133402476 16:5498842-5498864 AGATCCTGGTGCCAAGCCCAGGG - Intergenic
1133508016 16:6431155-6431177 AGATGCTACTGCAATGGTCTAGG + Intronic
1133558904 16:6931837-6931859 AGATACCAGTGCCATGCTCTTGG - Intronic
1133827342 16:9290171-9290193 AGATACTAGTGCCATGCTCTTGG - Intergenic
1134806183 16:17127486-17127508 AGATGCTGGTGCCAGTGACTGGG + Intronic
1134898663 16:17914349-17914371 AGATGCAGGTGCCATGTCCTTGG - Intergenic
1135417874 16:22282691-22282713 AGATGCTGGTGCTATGCTCTTGG + Intronic
1136035883 16:27539815-27539837 AGATGCTGGTGCCATGCTCTTGG + Intronic
1136560914 16:31038797-31038819 AGAGGCAGGTGCCATTCTCGGGG - Intronic
1136612543 16:31375411-31375433 AGATGCTGGTGCCATGTTCTTGG + Intronic
1136623431 16:31445614-31445636 TGATGCTGGTGCCATGCTGTTGG - Intergenic
1137292776 16:47063189-47063211 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1137384219 16:48026723-48026745 AAATGCTGGTACCTTGATCTTGG - Intergenic
1137389991 16:48073448-48073470 ATCTGCTGGTGCCTTGCTGTTGG - Intergenic
1137699374 16:50485438-50485460 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1137856706 16:51802026-51802048 AGATGCTGGTGCCATGCTCTTGG - Intergenic
1137898609 16:52240201-52240223 AGATGACAGTGCCATGCTTTTGG + Intergenic
1137909087 16:52357878-52357900 AGATGCCAGCACCATGCTCTTGG - Intergenic
1137932221 16:52599980-52600002 GGATGCGGGTCCCATGATCTTGG - Intergenic
1138244336 16:55455465-55455487 ATCTGCTGGTGCCATGATCTTGG + Intronic
1138304274 16:55960042-55960064 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1138318045 16:56087183-56087205 AGATGGTGGTGCCAATCCCTAGG + Intergenic
1138388131 16:56650462-56650484 ATATGCTGGTGCCTTGACCTTGG + Intronic
1138392520 16:56680888-56680910 ATATGCTGGTGCCTTGACCTTGG + Intronic
1138621775 16:58217124-58217146 AGATGCTTGCACCATGCTCTTGG + Intergenic
1138641191 16:58388703-58388725 AGACGCTGGTGCCTTGATCTTGG - Intronic
1138816766 16:60211443-60211465 AGATGCTGGCACCATGCTCTTGG + Intergenic
1139497482 16:67330988-67331010 AGATGTTGGCACCATGCTCTTGG - Intronic
1139693391 16:68655922-68655944 AGAGGCTGCTGACATGTTCTTGG + Intronic
1140008060 16:71099416-71099438 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1140337522 16:74122252-74122274 GCATGCTGGTGCCTTGATCTTGG - Intergenic
1140348031 16:74233866-74233888 AGATGCTGGCACCTTGATCTTGG + Intergenic
1140506192 16:75474633-75474655 AGATGCTGGCTCCTTGATCTTGG - Exonic
1140777658 16:78264828-78264850 ATCTGCTGGTGCCATGATCTTGG + Intronic
1141795298 16:86269024-86269046 AGATGCCAGCACCATGCTCTTGG - Intergenic
1142510219 17:388274-388296 ACATGCTGGTGCCATGCTCTTGG - Intergenic
1142824102 17:2496884-2496906 AGATGCCAGGGCCTTGCTCTTGG + Intronic
1143007267 17:3845467-3845489 AGATGCTGGGGCCACGGTGTAGG + Intronic
1143055446 17:4158704-4158726 AGCTGGTGGTGCCATTCCCTTGG - Intronic
1143274847 17:5702828-5702850 AGATGCTGGTGCCGTGTACTTGG + Intergenic
1143370966 17:6439178-6439200 AGATGCCAGCACCATGCTCTTGG - Intergenic
1143570903 17:7757764-7757786 ATCTGCTGGTGCCTTGCTCTTGG - Intronic
1143816908 17:9524336-9524358 ATCTGCTTATGCCATGCTCTTGG - Intronic
1143907400 17:10220135-10220157 AGGTGCCAGTGCCATGCTCTTGG + Intergenic
1144052381 17:11508286-11508308 AGATGCTGGTGCTTTGATCTTGG - Intronic
1144152852 17:12467202-12467224 AGATGCTGGTGCTATCCAGTAGG + Intergenic
1144180412 17:12746341-12746363 AGATACTGGTGCCATGTCCTCGG - Intronic
1144231790 17:13213405-13213427 GGATGCTGGTACATTGCTCTTGG - Intergenic
1144479579 17:15617772-15617794 AGATGCTGGTGCCATGCTTCTGG + Intronic
1144598373 17:16590483-16590505 AGATGCTGGCACCTTGATCTTGG + Intergenic
1144749153 17:17636182-17636204 AGATGTTGGCACCATGCTCTTGG + Intergenic
1144754956 17:17674077-17674099 AGATGCTGGTGCCATACTCTTGG - Intergenic
1144918722 17:18745967-18745989 AGATGCTGGTGCCATGCTTCTGG - Intronic
1145006017 17:19338253-19338275 ACCTGATGGTGCCCTGCTCTGGG + Intronic
1145123688 17:20282725-20282747 AGCTGCAGGGGCCATGCTCATGG - Intronic
1145727450 17:27144280-27144302 AGATGCCAATGCCATACTCTTGG + Intergenic
1145786271 17:27595798-27595820 AGATGCTGGTGCCGTTCTCAGGG + Intronic
1145834457 17:27943757-27943779 AGATGCTGGCACCTTGATCTTGG + Intergenic
1145958774 17:28873264-28873286 TGAGGCTGGTTCCAGGCTCTGGG + Intergenic
1146021417 17:29282208-29282230 AGAAGCTGCCGCCATGCACTTGG + Intronic
1146098110 17:29952058-29952080 ACTTGCTGGTGCCTTGATCTTGG - Intronic
1146180034 17:30692084-30692106 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1146476674 17:33168151-33168173 AGATGCTGGTGCCATGATCTTGG + Intronic
1146484840 17:33234644-33234666 ACCTGCTGGTGCCTTGATCTTGG - Intronic
1146511657 17:33454733-33454755 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1146774954 17:35605645-35605667 AGGTGTTGGTGCCAAGCTGTTGG - Intronic
1147229744 17:39008833-39008855 AGATGCTGGTGTCATGCTCTTGG + Intergenic
1148347999 17:46916811-46916833 AGATGACGGTGCCATGCTCTTGG - Intergenic
1148879284 17:50713370-50713392 CCATGCTGGTACCATGATCTTGG - Intergenic
1148977468 17:51542155-51542177 AGTTGCTGGTGGCTTGCTGTAGG + Intergenic
1149469713 17:56906287-56906309 AGATGCTGGAAGCATGCTCTTGG + Intronic
1149632468 17:58137816-58137838 AGATGCTGGTGCCTTGATCTGGG + Intergenic
1149966005 17:61164695-61164717 AGAGCCTGGTGTCATGCGCTTGG + Intronic
1150159228 17:62880912-62880934 AGATACTGGCACCATGCTCTGGG - Intergenic
1150188660 17:63214543-63214565 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1150897467 17:69230194-69230216 AGATATCAGTGCCATGCTCTTGG + Intronic
1151071186 17:71214121-71214143 AGATGCTCATGCCATGCTCTTGG + Intergenic
1151072629 17:71233358-71233380 ATATGCTGGCACCATGCTCTTGG + Intergenic
1152010737 17:77712311-77712333 AGATGCTGGCGCCATATTCTTGG + Intergenic
1152279005 17:79374285-79374307 AGATGGTGGTCCCTTGCCCTGGG - Intronic
1152294831 17:79460812-79460834 AGATGCCAGGGCCATGTTCTTGG + Intronic
1153077688 18:1183917-1183939 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1153092848 18:1368505-1368527 ACCAGCTGGTGCCATGATCTTGG - Intergenic
1153132877 18:1877459-1877481 ACATGCTGGTGCCTTCATCTTGG + Intergenic
1153279481 18:3400815-3400837 AGAGGCTGGTGCAATGCTCTTGG + Intergenic
1153334305 18:3906285-3906307 AAATGCTGTTGTCATGCTATGGG + Intronic
1153447169 18:5187448-5187470 AGATGCCAGTGCCATGATTTTGG - Intronic
1153770245 18:8409431-8409453 AGAAGCCAGTGCCATGCTGTGGG - Intergenic
1153849125 18:9077072-9077094 AGAGGCCCCTGCCATGCTCTAGG + Intergenic
1154000512 18:10478471-10478493 CCATGCTGGTGCCTTGATCTTGG - Intronic
1154392021 18:13945749-13945771 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1154938672 18:21088877-21088899 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1155068474 18:22290065-22290087 AAATTCTAGTGCCATGATCTTGG - Intergenic
1155198020 18:23493290-23493312 AGATGCCAGTACCATGCTCTTGG - Intergenic
1155229710 18:23760800-23760822 ATCTGCTGGTGCCTTACTCTTGG - Intronic
1155637652 18:27974835-27974857 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1155705985 18:28813414-28813436 AAATGCTGCCGCCATGCTCTTGG - Intergenic
1155882326 18:31164873-31164895 AGATGCCCATGCCATGCTCTTGG - Intergenic
1156118160 18:33812228-33812250 ACATGCTGGTGTCATCCTCTTGG - Intergenic
1156141007 18:34111546-34111568 ATATGCTGGTAGCTTGCTCTTGG + Intronic
1156224271 18:35087879-35087901 AGATGCTGGTTCCCTGATCTTGG - Intronic
1156226329 18:35112884-35112906 ATCTGCTGGTGCCTTGGTCTTGG - Intronic
1156474918 18:37399405-37399427 AGATGCTGGCTCCATGCCCTTGG + Intronic
1156828947 18:41467411-41467433 AAATGTTTGTGCCATGCTCTGGG - Intergenic
1157014189 18:43690192-43690214 AGATGCTGTTGCCATGCTCTTGG + Intergenic
1157151965 18:45227443-45227465 AAATGCTGGTGCCTTGATCTTGG - Intronic
1157191064 18:45582021-45582043 AGATGCTGGCACCATGTTCTTGG - Intronic
1157369140 18:47094232-47094254 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1157663586 18:49466829-49466851 ATATGCTGGTGCCTTGATCTTGG + Intergenic
1157786734 18:50490179-50490201 AGAAGATGCTGCCATGCCCTTGG - Intergenic
1157847030 18:51013587-51013609 AGATGCCAGTGCCGTGCTCTTGG + Intronic
1158403501 18:57141314-57141336 AGATGACGGTGCCATGCTTCTGG + Intergenic
1158420821 18:57292041-57292063 AGATGCTGGTGCCTTGATCTTGG + Intergenic
1159237909 18:65701303-65701325 AGATGCTAATGCCTTGCTTTTGG - Intergenic
1159239342 18:65720984-65721006 ATCTGCCAGTGCCATGCTCTTGG + Intergenic
1159392116 18:67806694-67806716 AAATGCTGGTGCCTTGATCTTGG + Intergenic
1159501624 18:69278760-69278782 AGATGCCGGTACCATGATCTTGG + Intergenic
1160113985 18:76059720-76059742 AGCTGCTGGTGCCTTGATCTGGG + Intergenic
1160233245 18:77065229-77065251 AGATGCCAGTGCCATGCCCTGGG - Intronic
1161599052 19:5169642-5169664 AGAGGCTGGAGCCTTGATCTTGG - Intronic
1162055718 19:8062716-8062738 AGTTGCTGCTGCCCTGCCCTGGG + Intronic
1162105689 19:8368355-8368377 GGATGCTGGTGCCAGGCTGTGGG + Intronic
1162306528 19:9877778-9877800 AGAGGCTGGTGCTATGCCCTTGG + Intronic
1162603538 19:11689187-11689209 AAAAGCTGGTGCCATGCTATTGG + Intergenic
1162868429 19:13566851-13566873 AGATGCTGGTGCCATGCTTCTGG + Intronic
1162877951 19:13634841-13634863 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1162888699 19:13716265-13716287 ATGCGCTGGTGCCTTGCTCTTGG - Intergenic
1163627975 19:18401814-18401836 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1164505186 19:28854374-28854396 AGGTGCTGGTGCCATGTTCTTGG + Intergenic
1164633680 19:29777751-29777773 AGTGGCTGGAGCCGTGCTCTGGG - Intergenic
1164699653 19:30275520-30275542 AGATGCTGTTGCCTTGCGTTGGG + Intronic
1164807852 19:31130647-31130669 AGATGCTGGTGCCTTGATCTTGG - Intergenic
1165184776 19:34008436-34008458 AGATGCTGGCCCCTTGATCTTGG - Intergenic
1167048304 19:47064501-47064523 AGAAGCTGGAGCCCTCCTCTTGG - Exonic
1167713424 19:51125787-51125809 TGAGGCTGGTGCCATGGTCCTGG - Exonic
1167736645 19:51298445-51298467 ACATGCTGGTGCCTGGATCTTGG + Intergenic
1167754662 19:51404657-51404679 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1167768434 19:51499504-51499526 TGAGGCTGGTGCCATGGTCCTGG + Exonic
1167812130 19:51842523-51842545 AGATACTGGTACCCTGATCTTGG + Intergenic
1168632451 19:57968084-57968106 AGCTGCTGATGCCTTGATCTGGG - Intronic
925243813 2:2360699-2360721 ATATGCTAGTGTCTTGCTCTTGG + Intergenic
925303161 2:2831144-2831166 AGATGCCAGTGCCATGCCCTTGG + Intergenic
925456582 2:4021604-4021626 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
925544055 2:4999908-4999930 AGATGCTGGTGCCATACTTTTGG + Intergenic
925600371 2:5602795-5602817 AGATGCTGGTGCAATGATCTTGG - Intergenic
925693623 2:6550906-6550928 AGATGTTGGTGACTTGATCTTGG + Intergenic
925693859 2:6553221-6553243 AGATGCTGATTCCTTGATCTTGG + Intergenic
925748314 2:7063952-7063974 AGATGCTGGTGCCACGCTCTTGG - Intronic
926051574 2:9748324-9748346 AAGGGCTGGTGCCATGTTCTTGG + Intergenic
926342225 2:11913169-11913191 AGATGCCAGTGTCATGCTCTTGG - Intergenic
926437116 2:12849420-12849442 AGATGCCAGTGCCATGCTCTTGG + Intergenic
927133835 2:20082384-20082406 AGATGCTGGTGCCATGCTTTTGG + Intergenic
927267694 2:21171534-21171556 AGATGCCTGTGTCATGCTCGTGG - Intergenic
927455883 2:23248842-23248864 GGAAGCTGGTGCCATGCCCATGG - Intergenic
927644387 2:24867487-24867509 AAATGCTGGTGCCTTGATCTTGG + Intronic
927758200 2:25725729-25725751 AGATGGTGGTGCCTTGACCTCGG - Intergenic
928431565 2:31223051-31223073 CTATGCTGGTGCCGTGATCTCGG + Intronic
928694026 2:33830494-33830516 ATATGTTGGTGCCTTGGTCTTGG + Intergenic
929269043 2:39952572-39952594 AGATGCTGGTGCCATACTCTTGG + Intergenic
929533241 2:42765057-42765079 AGGTGCTGGTTCCAGGCTCCAGG + Intergenic
930107186 2:47649548-47649570 ATATGCTGGTGCCTTGATCTTGG + Intergenic
930289508 2:49475997-49476019 AGATGCTGGCACTGTGCTCTTGG + Intergenic
930876315 2:56221889-56221911 AGATACCAGTGCCACGCTCTTGG - Intronic
931333283 2:61311318-61311340 AGATGCTGGTACCCTGATCTTGG + Intronic
931381042 2:61753685-61753707 AGATGCTTGTGCTATGCTCTTGG - Intergenic
931685492 2:64788843-64788865 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
931687962 2:64810730-64810752 AGATGCTGGTGCCTTGATCTTGG + Intergenic
931838097 2:66120969-66120991 AGATGCCAGTGCCATGCTCTTGG - Intergenic
931937819 2:67217604-67217626 AGAAGCTGGTGTCATGTTCTTGG + Intergenic
932007001 2:67937225-67937247 AGATGCCGGTGCCATATTCTTGG + Intergenic
932063935 2:68533198-68533220 AGATGCTGGTGCCTTGATCTTGG + Intronic
932298782 2:70648690-70648712 AAATGCTGGTGCCTTGATCTTGG + Intronic
932536905 2:72607351-72607373 AGATGCCAGCGCCATGCTTTTGG + Intronic
932562093 2:72882223-72882245 AGATTCTTGTGCCATGCTCTTGG - Intergenic
932633504 2:73367646-73367668 AGATGCTGGCACCTTGCTCTTGG + Intergenic
932634347 2:73375044-73375066 AACTGCTGGTGCCTTGATCTTGG + Intergenic
932634461 2:73376237-73376259 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
932689173 2:73897738-73897760 ATCTGCTGGTGCCTTGATCTTGG - Intronic
932802634 2:74755451-74755473 AGCTGCTGGTGACTTGATCTTGG - Intergenic
932835591 2:75032956-75032978 AGATGCTGGTGCCATCCTTTTGG + Intergenic
932861548 2:75297931-75297953 AGATGCCAGTGCTATGCTCTTGG + Intergenic
932893572 2:75617108-75617130 AGATGCCAGTGCCATGCTCTTGG - Intergenic
933732335 2:85466741-85466763 AGATGCCAGCACCATGCTCTTGG - Intergenic
934070664 2:88380962-88380984 AGATGCTGATGCCTTGATCATGG + Intergenic
934680731 2:96282100-96282122 CGCTGCTGGTGCCTTGCTCTGGG + Intronic
934706448 2:96484898-96484920 AGATGCCAGAGCCATGCCCTTGG + Intergenic
934942463 2:98512500-98512522 AGATGCGGGCACCATGCTCCAGG - Intronic
934945811 2:98540605-98540627 AGATGCCAGTACCATGCTTTTGG - Intronic
935024464 2:99263016-99263038 AGATGCCAGCACCATGCTCTTGG - Intronic
935035918 2:99373315-99373337 CAATGCTGGTGCCTTGATCTTGG - Intronic
935235308 2:101133523-101133545 ATCTGCTGGTGCCTTGATCTTGG - Intronic
935239240 2:101164036-101164058 AGAAGCTAGTGCCATGGTATTGG + Intronic
935268684 2:101415380-101415402 ATCTGCTGGTGCCTTGATCTTGG + Intronic
935539614 2:104334158-104334180 AGATGTTGGTGCCATGCTCCTGG + Intergenic
935647586 2:105353026-105353048 AGGTGCCAGTGCCATGCTCTTGG - Intergenic
935667031 2:105521762-105521784 AGATGCTGGTGCCATGCTCTCGG - Intergenic
935870019 2:107438066-107438088 AGATGCCAGTGCCATACTCTTGG + Intergenic
935870762 2:107446624-107446646 AGAAGCTGGTGCCATGCTTCTGG - Intergenic
935946443 2:108290570-108290592 AGATGCCAGCACCATGCTCTTGG - Intronic
936044855 2:109179561-109179583 AGATGCCAGTACCATGTTCTTGG - Intronic
936045206 2:109182218-109182240 AAATGCCAGCGCCATGCTCTTGG - Intronic
936095250 2:109526264-109526286 AGAGGCTGGTGCCTTGCCCAGGG - Intergenic
936445621 2:112592386-112592408 AGATGCAGGCACCGTGCTCTTGG + Intergenic
936773606 2:115945101-115945123 AGATGCTGGCACTATGCTCTTGG - Intergenic
936820844 2:116518660-116518682 AGATGCTGGTGCTGTGCTACTGG + Intergenic
937116114 2:119406213-119406235 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
937134170 2:119538046-119538068 AGATGCTGGTGACAAACTATTGG - Intergenic
937134361 2:119540188-119540210 ATGTGCTGGTGCCTTGATCTTGG + Intergenic
937240469 2:120457999-120458021 ATCTGCTGGTGCCCTGGTCTTGG + Intergenic
937253151 2:120536694-120536716 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
937282796 2:120731823-120731845 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
937460820 2:122084205-122084227 AGATGCTAGTGCCACACTCTTGG - Intergenic
937496572 2:122426482-122426504 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
937589898 2:123600246-123600268 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
937649316 2:124302430-124302452 AGATGCCAGAGACATGCTCTTGG - Intronic
937934368 2:127230778-127230800 TGATGCTGGTGCCTTAATCTTGG + Intergenic
938089296 2:128420742-128420764 AGATGCTGGCGCCTTGATGTCGG + Intergenic
938228998 2:129641619-129641641 GGATGCTGGTGCCCTTCTCCAGG - Intergenic
938247886 2:129792976-129792998 AGATGTTGGCACCATGTTCTTGG + Intergenic
938412093 2:131073642-131073664 AGATGCCATCGCCATGCTCTTGG + Intronic
938713728 2:133999700-133999722 AGATGCTGGCACCATGGGCTTGG - Intergenic
938809204 2:134836624-134836646 AGCTCCTGGTGCAATGTTCTTGG + Intergenic
938903094 2:135815107-135815129 ACATGCTGGTCCCTTGATCTTGG + Intronic
939072921 2:137565333-137565355 AGAAGCTGCTGCCATGTCCTTGG - Intronic
939119558 2:138100302-138100324 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
939892011 2:147747439-147747461 AGATGCCAGTGCCATGCCTTTGG + Intergenic
939988205 2:148852998-148853020 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
940042004 2:149370575-149370597 ATCTGCTGGTGCCCTGATCTTGG + Intronic
940093813 2:149951506-149951528 AGATGCTGATTCCTTGATCTTGG - Intergenic
940174403 2:150862912-150862934 AGATGCTGGTGCCTTGATCTTGG - Intergenic
940174724 2:150865409-150865431 AGATGCTGGTGCCTTAATCTTGG - Intergenic
940191391 2:151043826-151043848 AAATGCCAGTGCCATGATCTTGG + Exonic
940220826 2:151349563-151349585 AGATGGTGGTGTCATGGACTGGG + Intergenic
940382328 2:153029845-153029867 AGATCCCGGCACCATGCTCTTGG - Intergenic
940383386 2:153042517-153042539 AGATGCCAATGCCATGCTCTTGG + Intergenic
940403682 2:153275504-153275526 AGATGCTAGTGCCTTGATCTTGG + Intergenic
940515336 2:154677271-154677293 AGATGCTGGCATCATGGTCTTGG + Intergenic
940515853 2:154683139-154683161 AAATGCTGATGCCATGGTCTTGG + Intergenic
940667080 2:156621827-156621849 AGATGCCAGTGCCATGCCCTTGG + Intergenic
940682755 2:156807013-156807035 AGATGCCAGCACCATGCTCTTGG - Intergenic
940941936 2:159571730-159571752 AGATGCCAGTGCCATGCTCTTGG - Intronic
941392139 2:164927247-164927269 AAATGCTAGTGCCTTGATCTTGG + Intronic
941685955 2:168448958-168448980 AGATGCCAGTGCCATGCTCTTGG + Intergenic
941709430 2:168696611-168696633 ATCTGCTGGTGCCTTGATCTGGG - Intronic
941879334 2:170465228-170465250 AGATGCTGGTGCCAGGCTTGTGG - Intronic
942012690 2:171778698-171778720 AGATGCCAGCACCATGCTCTTGG - Intergenic
942174387 2:173317854-173317876 AGATGCCAGTGCCATGCTCTTGG - Intergenic
942198942 2:173551808-173551830 AAATGTCAGTGCCATGCTCTTGG - Intergenic
942225006 2:173807413-173807435 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
942307881 2:174626757-174626779 ACATGCTGGTGCCATGGACAAGG - Intronic
942376932 2:175347291-175347313 AGATGCTGGAGCCATGCTATTGG - Intergenic
942426889 2:175869478-175869500 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
942527298 2:176867924-176867946 AGATGCTGGTGACATGCTCTTGG + Intergenic
942803315 2:179901206-179901228 AGATGCTGGCACCATGCTCCTGG - Intergenic
942814961 2:180042153-180042175 AAATGATGGTGCCTTGATCTTGG + Intergenic
943025232 2:182619834-182619856 AGGTGCTGGTACCATGCCCTAGG - Intergenic
943083547 2:183284643-183284665 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
943136564 2:183920287-183920309 AGATGCCAATGCAATGCTCTTGG - Intergenic
943322838 2:186466878-186466900 AGAGGCTGGTGCCTTGACCTTGG + Intergenic
943539386 2:189193073-189193095 AGATGCTGGCCCCTTGATCTTGG + Intergenic
943567170 2:189529684-189529706 AGATGCTAGCACCATGCTCTTGG + Intergenic
943623548 2:190176012-190176034 ACCTGCTTGTGCCATGATCTTGG + Intronic
943690805 2:190868025-190868047 AGATGCCAGTGCCATGCTCTTGG - Intergenic
943719474 2:191188843-191188865 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
943781523 2:191829372-191829394 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
943939437 2:193972954-193972976 AGATGCCAGTGCAATGCTTTTGG - Intergenic
944029442 2:195216538-195216560 CCATGCTGGTGCCCTGATCTTGG - Intergenic
944287672 2:197970164-197970186 AGATGCTGGTACCATCCTCTTGG - Intronic
944303445 2:198152097-198152119 AGATGCCAAAGCCATGCTCTTGG - Intronic
944900460 2:204208664-204208686 AGATGCCAGTGCCATGCTCCTGG - Intergenic
944921844 2:204422380-204422402 AGATGCCAGTGCCAACCTCTAGG - Intergenic
945023662 2:205599448-205599470 AAATGTTGGTGCCATGTTATTGG - Intronic
945071177 2:205990499-205990521 AGATGCTGGTGCCTTGATCTTGG + Intergenic
945081806 2:206093623-206093645 AGATGTCAGCGCCATGCTCTTGG - Intergenic
945511582 2:210709625-210709647 AGATGCTGGCACCATACTCTTGG - Intergenic
945776179 2:214109133-214109155 AAATGATGGTGCCATGCTCTGGG + Intronic
945899739 2:215524357-215524379 AGATGCTGGTGCCTTGATCTTGG + Intergenic
946045908 2:216820804-216820826 ACCTGCGGGTGCCATGATCTTGG + Intergenic
946221605 2:218232452-218232474 AGATGCTGGTGCCACGCTCTTGG - Intronic
946356758 2:219190977-219190999 AGCTGCTGGTGCCTTGATCTTGG + Intergenic
946481485 2:220060939-220060961 TGATACTGGTGCCTTGATCTTGG + Intergenic
946535392 2:220622196-220622218 AGATGCTGGCACCATGCTCTTGG - Intergenic
946638803 2:221760637-221760659 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
946660821 2:221997646-221997668 AGGTGGTGGTTCCAGGCTCTGGG - Intergenic
946812537 2:223541114-223541136 AGATGCCAGTGCCATGCTTCTGG + Intergenic
947404488 2:229760688-229760710 AGATGCCAGTGCCATGCTCCTGG + Intergenic
947574677 2:231263365-231263387 AGATGCTGGCGCCATGCTCTTGG - Intronic
947682649 2:232049563-232049585 AGATGCTGGTGGCTTAATCTTGG + Intronic
947951283 2:234149571-234149593 AGATTCTGGAGCCATGCTCTTGG + Intergenic
948364652 2:237446879-237446901 AGGTGCTGGTGTCTTGATCTTGG - Intergenic
948552104 2:238779472-238779494 AGGAGCTGGTTCCATGATCTGGG + Intergenic
948875812 2:240827273-240827295 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
948948639 2:241234924-241234946 AGAGAAAGGTGCCATGCTCTTGG + Intronic
948986301 2:241526569-241526591 AGATGCTGGTGCCCTGCCCTTGG - Intergenic
1168863943 20:1068190-1068212 ACATGCTGCTGCCTTGATCTTGG - Intergenic
1168961490 20:1873013-1873035 AGATGCCAGCTCCATGCTCTTGG + Intergenic
1169039399 20:2480579-2480601 AGGTGCTGGCACCATGCTCTTGG + Intronic
1169250295 20:4055410-4055432 GGACGCTGGTGCCATGCTCTTGG + Intergenic
1169510660 20:6260518-6260540 AGATGCAAGTTCCATCCTCTTGG + Intergenic
1169737305 20:8850755-8850777 ATCTTCTGGTGCCATGGTCTTGG + Intronic
1169830845 20:9823241-9823263 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1169846220 20:9994859-9994881 AGATGCTGGCACCATGCTCTTGG - Intronic
1170030021 20:11934968-11934990 AGATGCCAGTGCCATGCTCTTGG - Intergenic
1170497202 20:16937528-16937550 GGGTGCTGGTGCCATGCTCTTGG - Intergenic
1170530927 20:17290807-17290829 AGATGCCAGCACCATGCTCTCGG - Intronic
1170842093 20:19932292-19932314 AGATGCCAGAGTCATGCTCTCGG + Intronic
1171008317 20:21490465-21490487 ACCTGCTGGTGCCTTGGTCTTGG - Intergenic
1171132594 20:22667398-22667420 AGATGCTGATGCCATGCTCTTGG - Intergenic
1171223914 20:23424742-23424764 AGAGGCTAGTGCCATCCACTAGG - Intergenic
1171399749 20:24865222-24865244 AGATGCCAGTGCCATGCTCTTGG - Intergenic
1171405294 20:24908840-24908862 AGAAGCTACTGCCATGCCCTTGG + Intergenic
1171452169 20:25243773-25243795 AGATGCCAATGCCATGCTCTTGG - Intergenic
1172038063 20:32024223-32024245 TGCTGCTGGTACCATGCTGTGGG - Intronic
1172318615 20:33977732-33977754 AGATGCTAATGCAATGTTCTTGG - Intergenic
1173010680 20:39178955-39178977 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1173163264 20:40668364-40668386 AGATGCTGCTGACTTTCTCTGGG - Intergenic
1173295432 20:41751186-41751208 AGATGCTGGTGTCTTGATCTTGG + Intergenic
1173433013 20:43008353-43008375 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1173492904 20:43497815-43497837 AGATGCTGGTGCCATGCTCTTGG + Intergenic
1173707494 20:45123477-45123499 ATCTGCTGGTGCCTTGATCTTGG - Exonic
1174217738 20:48930141-48930163 AGATGCTAGTGCCATGCTCTTGG - Intronic
1175253690 20:57625368-57625390 AGAGGCTGGTGTCATGCTCTTGG - Intergenic
1175483011 20:59324675-59324697 AGCTGCAGGCGTCATGCTCTGGG - Exonic
1176006886 20:62870192-62870214 ATATGCTGGTGCCTTGATCTGGG - Intergenic
1176378274 21:6097850-6097872 AGATGCCAGTGCCATGCTCTTGG - Intergenic
1176997073 21:15567921-15567943 AGATTCTAGTGCCATGCTCTTGG - Intergenic
1177007147 21:15687433-15687455 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1177079229 21:16617697-16617719 AGATGCTGGTTGCTTGGTCTTGG - Intergenic
1177182604 21:17759022-17759044 AGATGCTAGTGCTATGCTTCTGG + Intergenic
1177190938 21:17850278-17850300 ATATGCTGGTGCCTTGCTCTTGG - Intergenic
1177201060 21:17956614-17956636 ATATGCTGGTGCCTTGATCTTGG - Intronic
1177256024 21:18663811-18663833 AGATGCTGGCCCCTTGATCTTGG - Intergenic
1177282332 21:18997654-18997676 AGATGCTGGGGCCATGCTCTTGG + Intergenic
1177324634 21:19568717-19568739 AGATGCTGGCACCATGCTCTTGG - Intergenic
1177478515 21:21655087-21655109 AGATGCTGGTCCCATGTTCCTGG - Intergenic
1177671304 21:24232798-24232820 AGATGCTAGCACCATGTTCTTGG - Intergenic
1177804617 21:25862239-25862261 ATTTGCTGGTGCCTTGATCTTGG - Intergenic
1177866470 21:26518520-26518542 AGATGTTGACACCATGCTCTTGG + Intronic
1178066212 21:28907252-28907274 AAATGCTGGTGCCTTGATCTTGG + Intergenic
1178126588 21:29522209-29522231 AGATGCCAGTGCCATGCTCTTGG + Intronic
1178237543 21:30859789-30859811 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1178252396 21:31016783-31016805 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1178362720 21:31962944-31962966 AGCAGCTGGTGCACTGCTCTGGG - Intronic
1178404713 21:32314857-32314879 AGAAGCTGGTGCTGTGCTCGAGG + Exonic
1178457412 21:32768261-32768283 AGATGCCTGTGCCATGCTCTTGG + Intronic
1178519943 21:33281012-33281034 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1178544648 21:33482550-33482572 AGATGCCAGCACCATGCTCTTGG - Intergenic
1178700136 21:34826358-34826380 AGATGCCAGCACCATGCTCTTGG + Intronic
1178700449 21:34828820-34828842 AGATGATGGCACCTTGCTCTTGG + Intronic
1178702407 21:34844761-34844783 AGATGCTGTTCCCCTGCTGTTGG - Intronic
1178730270 21:35095573-35095595 ACATCCTGGTGCCTTGATCTTGG + Intronic
1178842912 21:36152370-36152392 AGATGCTAGTGCCATGCTTTTGG - Intergenic
1178940865 21:36904029-36904051 AGATGCTGGCACCACACTCTTGG + Intronic
1179149829 21:38800268-38800290 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1179165174 21:38929842-38929864 AGATGCAAGTGCCAAGCACTTGG + Intergenic
1179250963 21:39671007-39671029 AGAGGCCAGTGCCAAGCTCTTGG - Exonic
1179350043 21:40600283-40600305 ATCTGCTGGTGCCCTGATCTTGG - Intronic
1179406409 21:41129837-41129859 AGATACTGATGCCTTGATCTCGG - Intergenic
1179745198 21:43440397-43440419 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1179836207 21:44035292-44035314 AGATGCTGGCACCTTGATCTTGG + Intronic
1179982768 21:44905232-44905254 AGATCCTGCCGCCCTGCTCTGGG + Intronic
1180166152 21:46030790-46030812 AGATTCTGGTGCCTTGATCATGG + Intergenic
1181790838 22:25264908-25264930 AGATACTGGTGCCATGCTCTTGG - Intergenic
1181826648 22:25521946-25521968 AGATACTGGTGCCATGCTCTTGG - Intergenic
1181829795 22:25551060-25551082 ACCTGCTGGCGCCTTGCTCTTGG + Intergenic
1182108934 22:27709175-27709197 AGATGCCAGCACCATGCTCTTGG + Intergenic
1182693817 22:32182825-32182847 ATCTGCTGGTGCCTTGCTCTTGG - Intergenic
1182817514 22:33178947-33178969 AGATGCTGGTATCATGCTCTTGG - Intronic
1183044275 22:35207351-35207373 ATATGCTGGTCCCTTGATCTTGG - Intergenic
1183343710 22:37295660-37295682 AGGTGCTGGAGCCAGGCTCCTGG - Intronic
1183572908 22:38667639-38667661 AGATACTTGCACCATGCTCTTGG - Intronic
1183829085 22:40408566-40408588 AGATGCTGGTTCAAAGCCCTTGG - Intronic
1184242646 22:43219361-43219383 AGATGCTGCTGCCGTGTTCTCGG + Intronic
1184346418 22:43916246-43916268 AGATGCTAGTGCCTTGATCCTGG + Intergenic
1184625112 22:45720867-45720889 AAATGCCAGTGCCATGTTCTTGG - Intronic
1184764806 22:46566497-46566519 AGATCCTGGCACCTTGCTCTTGG - Intergenic
1184948441 22:47821342-47821364 AGATGCCAGCACCATGCTCTTGG - Intergenic
1185096302 22:48807899-48807921 AGAAGCTGGTGCTGTACTCTTGG + Intronic
949110477 3:254673-254695 AGATGCTGATGCCTTGATCTTGG - Intronic
949153153 3:794576-794598 AGATGCAGGTGCCTTGATCTTGG + Intergenic
949266472 3:2162645-2162667 AGATGCTGTTGCCATTCTGCTGG + Intronic
949657439 3:6237022-6237044 GGAGGCTGGTGCCACGCTCTTGG + Intergenic
949657644 3:6239073-6239095 TGAAGCCAGTGCCATGCTCTTGG + Intergenic
949822054 3:8126138-8126160 AGATGCAGGTGCCATGCTCTTGG - Intergenic
949917954 3:8979453-8979475 AGATGCTAGTGTCATGTTCTTGG + Intergenic
949963791 3:9337637-9337659 AGATGCCAGTGCCATGCTCTTGG + Intronic
950152674 3:10699887-10699909 AGATGCCAGTGCCATGCTCTTGG + Intronic
950157516 3:10734158-10734180 AGATGCTGGTGCCATGCTCCTGG + Intergenic
950220695 3:11193487-11193509 ATCTGCTGGTGCCTTGATCTTGG - Intronic
950409248 3:12824364-12824386 AGATGCTGGTGCCATGTTCTTGG - Intronic
950506908 3:13400687-13400709 AGATCCTGGTGGCATTCTTTTGG - Intronic
950818323 3:15730999-15731021 AGATGCTAGTGCCTTGATCCTGG + Intronic
951084804 3:18499301-18499323 AGATTCTGGTGACATCATCTAGG - Intergenic
951284729 3:20795521-20795543 AGATGCCAGTGCCATGCTTTTGG + Intergenic
951522796 3:23625243-23625265 AGATGCTGGCACCATGCTCTTGG - Intergenic
951748184 3:26002858-26002880 ATCTGCTGGTGTCATGATCTTGG - Intergenic
951924151 3:27888600-27888622 AGATGCTGATCTCATGATCTGGG - Intergenic
951937726 3:28040374-28040396 GAATGAAGGTGCCATGCTCTTGG + Intergenic
952509832 3:34041906-34041928 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
952686234 3:36151777-36151799 AGTTGCTGGTGCCTTATTCTTGG - Intergenic
952740685 3:36731326-36731348 TGATGATGGAGCCATTCTCTGGG - Intronic
952740732 3:36731743-36731765 AGATGATGGTGGCTTGGTCTTGG - Intronic
952766765 3:36961078-36961100 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
953125624 3:40089044-40089066 AGATGCTGGTGTCATTCCCAGGG + Intronic
953361401 3:42300523-42300545 AGATGCTGGTGTCTTGATCTTGG - Intergenic
953659747 3:44883436-44883458 AGATGCTAGTGCCTTGATCTTGG + Intronic
953730955 3:45447611-45447633 AGATGTTGGCACCATGCTCTTGG + Intronic
953771977 3:45784804-45784826 AGATACTAGCACCATGCTCTTGG - Intronic
954815065 3:53273795-53273817 AGATGCTGGCTCCATGCTTCTGG - Intergenic
954901701 3:54025714-54025736 AAAAGCTGGTGCCATGGTATTGG - Intergenic
955165117 3:56503406-56503428 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
955359995 3:58265730-58265752 AGATATTGGTGCCATTCTCTTGG - Intronic
955504910 3:59622245-59622267 AGATGCTCACGCCATGCTGTTGG + Intergenic
955514520 3:59713586-59713608 AGATGTCAGTACCATGCTCTTGG - Intergenic
956106973 3:65829527-65829549 ATCTGCTGGTGCCTTGATCTTGG + Intronic
956378405 3:68640408-68640430 AGATGCTGGTGCCATGCTTTTGG - Intergenic
956449447 3:69358935-69358957 AGATGCCAGTGCCATGTTGTTGG + Intronic
956733329 3:72216755-72216777 GGATGCTGGTGCCATGCTCTTGG - Intergenic
957718649 3:83966831-83966853 AGATACTGGTGCCATTCTCTTGG - Intergenic
958018080 3:87966104-87966126 ATCTGCTGGTGACTTGCTCTTGG - Intergenic
958484514 3:94686767-94686789 AAATGCTGATGCTATGCTCTTGG + Intergenic
958836033 3:99146087-99146109 AAATGCTGGTGACTTGATCTTGG + Intergenic
959179049 3:102955345-102955367 AGATGCTGACACCATGTTCTTGG - Intergenic
959195195 3:103171502-103171524 CAACGCTAGTGCCATGCTCTTGG - Intergenic
959460712 3:106622529-106622551 AGATGCTTGTGACTTGATCTTGG - Intergenic
959977690 3:112480513-112480535 AGATGCTGGCACCATGCTCTTGG - Intronic
960538144 3:118835456-118835478 AAATGCTGGTCCCTTGATCTTGG - Intergenic
960694768 3:120385440-120385462 AGATGCCGGTGCCATAGTCTTGG - Intergenic
960977866 3:123193984-123194006 ACCTGCTGGTGCCTTGATCTTGG - Intronic
961000246 3:123369259-123369281 AGGTGCTGTCACCATGCTCTTGG + Intronic
961082092 3:124035083-124035105 AGGAGCTGGTGCCAGGGTCTGGG + Intergenic
961442176 3:126959669-126959691 ACAGGCAGGTGCCAGGCTCTGGG - Intronic
962025037 3:131538874-131538896 AGGTGCTGGTGCTATGCTCTTGG + Intronic
962045071 3:131749932-131749954 TGATGCTGGAGATATGCTCTTGG - Intronic
962167739 3:133067930-133067952 AGATGCTGGAACCATGCTCTTGG - Intronic
962242642 3:133764187-133764209 AGAAGCTGATGCCATGAGCTTGG + Exonic
962373724 3:134842233-134842255 ATCTGCTGGTGCCTTGATCTTGG + Intronic
962684103 3:137829977-137829999 AGAGCTTGGTGCCATGCCCTTGG - Intergenic
962687402 3:137860748-137860770 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
963045375 3:141098901-141098923 GGATGCCAATGCCATGCTCTTGG - Intronic
963173731 3:142277458-142277480 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
963678533 3:148345497-148345519 ACTTGCTGGTGCCTTGATCTTGG + Intergenic
964215008 3:154270054-154270076 AGATGCTGATACCTTGGTCTTGG + Intergenic
964316828 3:155454192-155454214 AAAAGCTGGTGCCATGGTATTGG - Intronic
964327775 3:155565577-155565599 AGATGCTGGCACCATGCTTCTGG + Intronic
964592381 3:158379050-158379072 AGATGGTGGTGACTTGGTCTAGG - Intronic
964648170 3:158981265-158981287 AGATGCTGGTGCCATGCTCTTGG - Intronic
964843924 3:161025670-161025692 AGAGGCTGGTGCCTTGATCTTGG + Intronic
965364189 3:167778024-167778046 TGATGCTGGTGCCATGCTCTTGG + Intronic
965441456 3:168720432-168720454 AGATGCTGGTGCCATGCTCTTGG - Intergenic
965523821 3:169696125-169696147 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
965553939 3:170000255-170000277 AGATCCCAGTGCCATGCTCTTGG - Intergenic
965768690 3:172158079-172158101 ATCTGCTGGTGCCTTGATCTTGG + Intronic
965864501 3:173189209-173189231 AGTTGCTGGTGATATGCTCTTGG + Intergenic
966056420 3:175696794-175696816 AGACATTGGTGCCATGTTCTTGG - Intronic
966119046 3:176501996-176502018 ATTTGCTGGTGCCCTGCTCTGGG - Intergenic
966216325 3:177506920-177506942 AGATGCCAGAACCATGCTCTTGG + Intergenic
966239716 3:177743041-177743063 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
966338713 3:178901313-178901335 AGATGCTGGCAACATGCTTTTGG + Intergenic
966339006 3:178903915-178903937 AGATGCTGGTGCCATTCCCTTGG + Intergenic
966393769 3:179480165-179480187 AGATGACAGTGCCATGCTCTTGG + Intergenic
966544669 3:181132346-181132368 AGATGCCAGTGCCATGCTCTTGG - Intergenic
967042399 3:185705685-185705707 ATCTGCTGGTGCCTTGATCTTGG - Intronic
967169176 3:186810795-186810817 ACAGCCTGGCGCCATGCTCTTGG + Intergenic
967240857 3:187438257-187438279 AGATGCTGGTGCCATGCTTTTGG - Intergenic
967380525 3:188852667-188852689 AGATGCTGGCACCATGATCTTGG + Intronic
967414466 3:189201096-189201118 ATGTGCTGGTGCCTTGATCTTGG + Intronic
967653534 3:192016796-192016818 AGAACCTGCTGCCATGCCCTGGG - Intergenic
967968398 3:194981932-194981954 AGGTGCTGATGCCATGCCCTTGG - Intergenic
968536011 4:1130092-1130114 AGATGCTGGTGTCATGCTCTTGG + Intergenic
969161945 4:5267963-5267985 CGATGCTTGGGGCATGCTCTTGG + Intronic
969256728 4:6007477-6007499 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
969277721 4:6148253-6148275 AAATGCAGTTGCCCTGCTCTTGG - Intronic
969440579 4:7214415-7214437 AGATGCCAGTGCTGTGCTCTTGG + Intronic
969718086 4:8877964-8877986 AGGTGCTGGGGCCAGGCCCTGGG - Intergenic
969849862 4:9947780-9947802 AGATCATGTTGCCAGGCTCTGGG - Intronic
969965246 4:10987249-10987271 ATCTGCTGGTGCCTTGATCTCGG + Intergenic
969970344 4:11040515-11040537 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
970084483 4:12331256-12331278 AGATGCTGGTGCCACACTCTTGG + Intergenic
970152879 4:13108251-13108273 AGATGCTGACACCATGCTTTTGG - Intergenic
970212310 4:13722326-13722348 AGCTACTGGTGCCATACTCCTGG + Intergenic
970282164 4:14469223-14469245 AGATGCTAATGCCATGCTCTTGG - Intergenic
970317232 4:14841095-14841117 AGATGCCAGTGCCATGCTCTTGG - Intergenic
970317458 4:14843021-14843043 TGATGCCGGGGCCATGCTTTTGG - Intergenic
970406032 4:15765365-15765387 AGATGATGGTGCCTTGCACTGGG - Intergenic
970599565 4:17630491-17630513 ATCTGCTGGTGCCTTGATCTTGG + Exonic
970659893 4:18273515-18273537 AGATGCCAGTGCCATGCTCTTGG - Intergenic
971023065 4:22557958-22557980 AGATGCTGGTGCCATGCTCTTGG + Intergenic
971241468 4:24892878-24892900 AGATGCTGGTGTCATGCTTCTGG - Intronic
971376026 4:26056398-26056420 TGATGCTGGTGCCGGGCTCCTGG - Intergenic
971459337 4:26877987-26878009 AGATGCTGGTGTCTTCATCTTGG + Intronic
971763906 4:30804664-30804686 ATCTGCTGGTGCCTTGCTCTTGG + Intronic
971938521 4:33185953-33185975 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
972181627 4:36474056-36474078 ATCTGCTGGTGCCGTGATCTTGG - Intergenic
972291383 4:37693224-37693246 AGATGCTGGCGCCATGCTCTTGG + Intergenic
972649980 4:41007316-41007338 AGATGCTGGTGTTATGCTCTTGG + Intronic
972949046 4:44295701-44295723 AGATGCTGGCACCTTGATCTTGG - Intronic
972973397 4:44604779-44604801 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
973062857 4:45750888-45750910 AGATGCTGTTGTCTTGATCTCGG - Intergenic
973595467 4:52484212-52484234 AGATGCTGGTACCTTGACCTTGG + Intergenic
973644241 4:52933971-52933993 AGATGTTGGTGACATGCCTTTGG + Intronic
973669950 4:53206974-53206996 AGATGCTGGAACCATGCTCTTGG - Intronic
973854752 4:55000115-55000137 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
973926835 4:55747526-55747548 ATCAGCTGGTGCCTTGCTCTTGG + Intergenic
973962664 4:56127203-56127225 AGATGCTAGTGCCTTGATCTTGG + Intergenic
974087052 4:57272821-57272843 AGATGCTGGCACCATGCTCTTGG + Intergenic
974444942 4:61967910-61967932 AGATTCTGGTGGTGTGCTCTTGG - Intronic
974549897 4:63358066-63358088 AGATACTGGTGCCTCGATCTTGG + Intergenic
974770483 4:66405111-66405133 AGATGCTGGTGCATTGGTCTTGG + Intergenic
974837266 4:67266096-67266118 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
975049230 4:69839256-69839278 AGATGCCAATGGCATGCTCTTGG - Intronic
975240024 4:72046474-72046496 AGACGCTGGCACCATCCTCTTGG + Intronic
975260284 4:72289826-72289848 AGATGCCAGTGCCATACTCTTGG + Intronic
975411894 4:74062552-74062574 AGAGGCTGATGCCCTGCTGTTGG + Intergenic
975425512 4:74222324-74222346 AGATGCTGGCACCTTGATCTTGG - Intronic
976080934 4:81353996-81354018 ATATGCTGGTACCTTGATCTTGG - Intergenic
976104699 4:81604205-81604227 AGATACTGGTGCTATAGTCTTGG + Intronic
976376315 4:84349703-84349725 AGATGCCAGTGCCATGCTCTTGG - Intergenic
976517361 4:85984347-85984369 ATCTGCTGGTGCCTTGATCTTGG - Intronic
976545374 4:86329116-86329138 AAATGCTGGTACCTTGTTCTTGG + Intronic
976589397 4:86834135-86834157 ACAGGCTGGTGCCATTCTCGTGG + Intronic
976605946 4:86982964-86982986 ATCTGCTTGTGCCTTGCTCTTGG + Intronic
976635270 4:87281096-87281118 ATCTGCTGGTGCCTTGATCTCGG + Intergenic
976738903 4:88338855-88338877 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
976951243 4:90833984-90834006 AGATGCCAGTGCCATACTCTGGG + Intronic
977130121 4:93225863-93225885 AGATGTGGGTGCCATGGTCTTGG - Intronic
977248556 4:94662471-94662493 AGAAGCTGGTGACATGTTCCTGG + Exonic
977355399 4:95940057-95940079 AGATGCTGGTGTCTTGATCTTGG - Intergenic
977652441 4:99485868-99485890 AGATGTTGGCACCATGCTTTTGG + Intergenic
977682371 4:99810750-99810772 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
977774135 4:100897305-100897327 ATAAGCTGGTGGCATGATCTTGG - Intergenic
977871175 4:102092540-102092562 AGAAGCTGGTGAAATGCTGTAGG + Intergenic
977873856 4:102125908-102125930 AGATGCCAGCACCATGCTCTTGG + Intergenic
977877249 4:102164313-102164335 AGGTGCCAGTGCCATGATCTTGG + Intergenic
977909384 4:102514513-102514535 AAATGCTGGTGCCTTGATCTTGG + Intronic
977976315 4:103270838-103270860 ATATGCTGGTGCCTTGATCTTGG - Intergenic
977983730 4:103357984-103358006 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
978361617 4:107936533-107936555 AGATGCCAGTGCTATCCTCTTGG + Intronic
978527014 4:109677732-109677754 AGATGCTGGTGCATTGATCTTGG + Intronic
978945560 4:114491589-114491611 AGATACCTGTGCCATGCTCTTGG + Intergenic
978947225 4:114514819-114514841 ATCTGCTGGTACCATGATCTTGG + Intergenic
979063386 4:116097051-116097073 AGATGCTGCTGCCATGGTGTGGG - Intergenic
979348112 4:119612735-119612757 ATCTGCTGGTGCCTTGATCTTGG + Intronic
979524409 4:121702320-121702342 AGACGCTGGTGCCATGCTCTTGG - Intergenic
979543938 4:121918219-121918241 ACCTGCTGGTGCCTTGATCTTGG + Intronic
979778865 4:124624347-124624369 AGATGCTGGTATAATGCTCTTGG - Intergenic
979824278 4:125214425-125214447 AGATGTTGGTGTCTTGTTCTTGG - Intergenic
980196748 4:129599388-129599410 AGGTGATGGTGCCTTGATCTTGG - Intergenic
980278595 4:130688089-130688111 AGATGTCAGTGCTATGCTCTTGG + Intergenic
980717226 4:136642159-136642181 AGATGCTAGTGCCACGTACTTGG - Intergenic
980804358 4:137792771-137792793 AGATGCTGTTGCCATGCTTCTGG - Intergenic
981016537 4:139979780-139979802 ACCTGCTGGTGCCGTGATCTCGG + Intronic
981260430 4:142712161-142712183 ATCTGCTGGTGCCTTGATCTTGG + Intronic
981421633 4:144556808-144556830 AGCTGCTGGAGCCATGCTGAGGG + Intergenic
981436323 4:144727150-144727172 CCATGCTGGTACCCTGCTCTTGG - Intronic
981488072 4:145308752-145308774 AGATGCTGCTGCCATGCCCTTGG - Intergenic
981522832 4:145681659-145681681 AGATGCTGGCACCATGTTCTTGG - Intronic
981572059 4:146162320-146162342 AGATGTTAGTGCCATGCTTTTGG + Intergenic
982086229 4:151839546-151839568 AGATGCTCGTGCCTTGATCTTGG + Intergenic
982099620 4:151955167-151955189 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
982211550 4:153040857-153040879 AGATGCTGGCGCCATGTTCTTGG - Intergenic
982277361 4:153650399-153650421 TGCCGGTGGTGCCATGCTCTTGG - Intergenic
982497609 4:156110353-156110375 GGATGCTGGTGCCATGCTATTGG + Intergenic
982554612 4:156843286-156843308 ATCTGCTGGTGCCTTGATCTTGG + Intronic
982624273 4:157745794-157745816 AGAAGCTGGCACCATGTTCTTGG + Intergenic
982885866 4:160782335-160782357 AGATGCCAGTGCCATGCTCTTGG - Intergenic
983000190 4:162404994-162405016 ATCTGCTAGTGCCTTGCTCTTGG - Intergenic
984110465 4:175606880-175606902 CAATGCTGGTGCCCTGATCTTGG - Intergenic
984150637 4:176125907-176125929 AGATGCCTGTGCCATGCTCCTGG - Intronic
984275906 4:177608715-177608737 AGATGCCAGGGCCATGCTCTTGG + Intergenic
984697085 4:182790229-182790251 AACTGGTGGTGCCATGCTCTGGG - Intronic
984756414 4:183329461-183329483 AGATGCCAGTGCCATGGTCTTGG - Intergenic
984789219 4:183599470-183599492 AGATGCTAGCACCATGCTCTTGG + Intergenic
984919067 4:184748190-184748212 AGAGGCTGGTGCAATGGTCCTGG + Intergenic
985310946 4:188598016-188598038 AGATACTAGTGCCATCATCTTGG - Intergenic
985325716 4:188767563-188767585 AGATGCTGGTGCCTGGATCTTGG - Intergenic
986138172 5:5002835-5002857 AGATGCTGGTACCTTAATCTTGG - Intergenic
986148806 5:5107655-5107677 AGGTTTTGGTGCTATGCTCTTGG + Intergenic
986178084 5:5368905-5368927 AGGGGCTGGTGCCATGCCCTTGG - Intergenic
986396443 5:7335488-7335510 AGATGCTGGTGCCATGCACTTGG - Intergenic
986618119 5:9640925-9640947 CCATGCTGGTGTCATGGTCTGGG - Intronic
986674540 5:10171469-10171491 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
986874308 5:12088718-12088740 AGATGTGGGCACCATGCTCTTGG - Intergenic
986974080 5:13375189-13375211 AGATGCTGGTGTCATGATTCGGG - Intergenic
987051006 5:14146107-14146129 AGATGCTAGAGCCAAGATCTAGG - Intronic
987173114 5:15279354-15279376 AGATGCAGATGTCATGGTCTTGG + Intergenic
987324269 5:16798132-16798154 AGATGCCAGCGCCATGCTCTTGG + Intronic
987479792 5:18439237-18439259 AGATGCCAGTGCTATGCTCTTGG + Intergenic
987799288 5:22672579-22672601 GGATGCTGTCCCCATGCTCTTGG + Intronic
987880916 5:23744370-23744392 AGATGCTGGTGCCGTGGTTTTGG + Intergenic
988156524 5:27458805-27458827 AGATGCCTGTGCCATGCTTCTGG - Intergenic
988224369 5:28392908-28392930 ACTTGCTGGTGCCTTGATCTTGG + Intergenic
988442963 5:31253058-31253080 ATTTGCTGGTGCCTTGATCTTGG - Intronic
988610683 5:32721831-32721853 AGATGCCAGCACCATGCTCTTGG - Intronic
988641420 5:33044835-33044857 AGATACCAGTGCCATGCTCTTGG - Intergenic
988701075 5:33675077-33675099 AGATGCTGGTGCCATGATCTTGG + Intronic
989321956 5:40144945-40144967 AGATGCCAGTGCCATGCTCTTGG + Intergenic
989348619 5:40458265-40458287 AGATGCCAGTACCATGCTCTTGG + Intergenic
989476071 5:41874467-41874489 ATATGCTGGTGCCTTGATCTTGG - Intergenic
989481658 5:41937700-41937722 AGATGCTGGTGCCTTAATCTTGG - Intronic
989506868 5:42236377-42236399 AACTGCTGGTGCCTTGATCTTGG - Intergenic
989744938 5:44817786-44817808 ATCTGCTGGTGCCTTGATCTTGG + Intronic
989752278 5:44909663-44909685 AGCTGCTTGTGCCATGCACATGG - Intergenic
990180484 5:53155418-53155440 AGATGCTGGTTCCCTGATCTTGG + Intergenic
990316354 5:54586491-54586513 AGATGCCAGTGCCATGTTCTTGG - Intergenic
990391975 5:55332577-55332599 AGAGGCCTGTGCCATGTTCTTGG - Intronic
990697937 5:58443232-58443254 AGATGCTAGCTCCATGCTCTTGG + Intergenic
990846755 5:60149260-60149282 AGGTGCTGATACCATGCTCTTGG - Intronic
990880676 5:60533977-60533999 AGATGGTGGCACCATGCTCTCGG + Intergenic
991007806 5:61846999-61847021 AAATGCTGGGGCCATGTCCTTGG + Intergenic
991190632 5:63868809-63868831 AGATGCCAGTGCCTTGATCTGGG + Intergenic
991327596 5:65454176-65454198 AGATGCTGGTGCCATGCTCTTGG + Intronic
991514858 5:67424046-67424068 AAATGCTGGTGCCTTGATCTTGG + Intergenic
991568063 5:68025714-68025736 AGATGTTGGTGCTATGATCTTGG - Intergenic
991588219 5:68221136-68221158 AGATGCTAGTGCCATGCTCTTGG + Intronic
991917367 5:71618395-71618417 AGATGCCAGTGCCATGCTCTTGG + Intronic
991929032 5:71733526-71733548 ACTTGCTGGTGCCTTGATCTTGG - Intergenic
991993271 5:72362385-72362407 AAATGCTGGTGTCTTGTTCTTGG + Intergenic
992127476 5:73656583-73656605 AGATGCAGTTGCCATAATCTAGG - Intronic
992290379 5:75273362-75273384 AGAAGCTGCTGCCATGCCCTTGG + Intergenic
992757629 5:79923612-79923634 AGATGCCAGTGCCATGCTGTTGG - Intergenic
992810424 5:80382313-80382335 ACATGCTGGTACCTTGATCTCGG - Intergenic
992920883 5:81518515-81518537 AGATGCTGGTGCCTTAATCTTGG + Intronic
993254811 5:85576730-85576752 AAATGCTAGTGGCATGCTCTTGG + Intergenic
993319153 5:86451625-86451647 AGATGCCAGCACCATGCTCTTGG + Intergenic
993591159 5:89796701-89796723 AGATACTAGTGCAATGTTCTTGG + Intergenic
993972319 5:94434658-94434680 AGATGCTGGCGCCATGCTCTTGG - Intronic
993973674 5:94450503-94450525 AGATGCTGGTGCCTTGATCTTGG - Intronic
994163282 5:96581009-96581031 ATCTGCTGGTGCCTTGGTCTTGG + Intronic
994168130 5:96629275-96629297 AGATGCTAGTGCCTTGCTCTTGG + Intronic
994343056 5:98654557-98654579 AGATGACAGTGCCATGTTCTTGG - Intergenic
994714460 5:103305155-103305177 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
994958955 5:106572974-106572996 AGATGCTGTTGCCTTGTTCCTGG + Intergenic
995237943 5:109851566-109851588 AGATGCCAGTGCCATGCTCTTGG + Intronic
995485068 5:112632074-112632096 AGATGACAGTGCCATGTTCTTGG - Intergenic
995494884 5:112731368-112731390 AGATGCTGGTGCCATGCTCTTGG - Intronic
995506987 5:112870833-112870855 ATATACAGGTGCCATGCTTTTGG + Intronic
995585429 5:113643445-113643467 AGATGACAGTGCCATGCTCTTGG + Intergenic
995827989 5:116322817-116322839 AAATGCAGGTGCCTTGATCTTGG - Intronic
996049028 5:118910805-118910827 ATCTGCTGGTGCCTTGATCTTGG - Intronic
996173568 5:120326639-120326661 AGATGCTGGTGCCATGCTTTTGG + Intergenic
996231838 5:121074047-121074069 ATTTGCTGGTGTCATGATCTTGG - Intergenic
996331261 5:122331608-122331630 ATCTGCTGGTGCCTTGATCTTGG - Intronic
996413635 5:123186071-123186093 AGATGCTGGGCCAGTGCTCTAGG + Intronic
996414441 5:123195047-123195069 AGATGATGGTACCTTCCTCTAGG + Intergenic
996506731 5:124276341-124276363 CCATGCTGGTGCCTTGATCTTGG - Intergenic
996586219 5:125090619-125090641 AAATGGTGGTGCCTTGGTCTTGG - Intergenic
996634323 5:125671853-125671875 TGACGCTGGTGCCTTGGTCTTGG - Intergenic
996951826 5:129135976-129135998 AGATGCTAGTGCCATGCTCTTGG + Intergenic
997090107 5:130846552-130846574 AGATGCTAATGGCATGCTTTTGG - Intergenic
997502498 5:134387580-134387602 AGGTGCTGGCGCCATGCTCTTGG - Intronic
997668732 5:135653109-135653131 AGATGCTGGCACCCTGATCTTGG + Intergenic
997909401 5:137855039-137855061 ATCTGCTGGTGCCTTGGTCTTGG + Intergenic
998288796 5:140891909-140891931 AGATGCTGGTGCCTTGATCTTGG + Intronic
998376808 5:141696451-141696473 AGGTGCTGGTGATATGGTCTTGG - Intergenic
998485930 5:142502158-142502180 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
998593721 5:143505544-143505566 AGATGCTGGGACCATGTTCTTGG - Intergenic
998677554 5:144426674-144426696 AGATGCTGGTGCCATGCTCCTGG - Intronic
998826750 5:146109445-146109467 ATATGCTGGTGCCTTCCTCTTGG - Intergenic
999374462 5:151077096-151077118 AGATGGTGGTGTCATGCACTTGG - Intronic
999578317 5:153005777-153005799 AGATGCTGGTACCTTGATCTTGG + Intergenic
999675601 5:153998621-153998643 AGATGCCACTGCTATGCTCTTGG + Intronic
999735340 5:154508905-154508927 AGATGCCGGCACCATGCCCTTGG + Intergenic
1000308474 5:160018228-160018250 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1000551132 5:162666062-162666084 AGAGGCCTGTGCCATGCTCTTGG - Intergenic
1000694188 5:164359466-164359488 AGATGCCAGCACCATGCTCTTGG + Intergenic
1000773029 5:165380842-165380864 AGTTGCCAGTGGCATGCTCTTGG - Intergenic
1000826015 5:166044756-166044778 AGATGATGGTGCCATGTTCTTGG - Intergenic
1000840639 5:166213620-166213642 AGTTGCTGGCTTCATGCTCTTGG - Intergenic
1000846668 5:166290453-166290475 AGATGCCAGTGCCATGCTCTTGG - Intergenic
1001021754 5:168188994-168189016 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1001032630 5:168273959-168273981 AGATGCCAGTGCCATGCTCTTGG - Intergenic
1001046333 5:168374852-168374874 AGATGCTGGAGGTATTCTCTAGG + Intronic
1001361932 5:171095054-171095076 AGATGCTGGTACCATATTCTTGG + Intronic
1001446862 5:171792072-171792094 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1001620050 5:173076137-173076159 AGATGCCAGTGTCATGTTCTTGG - Intronic
1001695829 5:173669093-173669115 ATATACCAGTGCCATGCTCTTGG - Intergenic
1001765620 5:174244099-174244121 AGATGCAGGCACCATGCTCTTGG - Intergenic
1001966462 5:175913368-175913390 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1002105429 5:176877444-176877466 GGATGCTGCTGCCCTGCCCTTGG + Intronic
1002250486 5:177925836-177925858 ATCTGCTGGTGCCCTGATCTTGG + Intergenic
1002318715 5:178362370-178362392 AGAGGCTGGTGTCGTGCTGTGGG - Intronic
1002461261 5:179375085-179375107 AGATGCTGCTGCCATGCCTCCGG - Intergenic
1002601954 5:180358859-180358881 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1002610013 5:180411197-180411219 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1002613981 5:180438972-180438994 AGCTGCTGGTGCCGTGACCTTGG + Intergenic
1002788434 6:421382-421404 AGGTACCAGTGCCATGCTCTTGG - Intergenic
1003328439 6:5110090-5110112 GGATGCTGGAGCCATCCTCTGGG + Intronic
1003417481 6:5925000-5925022 AGATGCTGGTACCATGCTCTTGG - Intergenic
1003538427 6:6996678-6996700 AGATGCTGGAGCCTTGATCTTGG + Intergenic
1003622129 6:7709743-7709765 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1003724428 6:8744345-8744367 AGATGCTGGCCCCTTGATCTTGG + Intergenic
1004177487 6:13352557-13352579 AGATGCCAGTGCCATGCTGTTGG + Intergenic
1004289281 6:14351666-14351688 ATATGCTGGTGCCTTGATTTTGG - Intergenic
1004301455 6:14461868-14461890 ACATGCTGGTGCATTGATCTTGG - Intergenic
1004994903 6:21180972-21180994 AGATGCTGCTGCCAGGCTCTTGG - Intronic
1005011187 6:21337166-21337188 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1005878503 6:30034748-30034770 AAATGCTGGTGGCTTGATCTTGG + Intergenic
1006036221 6:31214887-31214909 AGATGCTGATACCATGCTCTTGG - Intergenic
1006074629 6:31523729-31523751 AGATGCCAGTGTCATGCTCTTGG - Intergenic
1006101564 6:31689072-31689094 AGATGTTAGTGCCATGATCCTGG - Exonic
1006250199 6:32777180-32777202 AGATGCTGGCACCATGCTCTTGG - Intergenic
1006250596 6:32780213-32780235 AGATGCTGGCACCATGCTCTGGG - Intergenic
1006270727 6:32964949-32964971 AGATGCCAATGCCATGCTCTTGG + Intronic
1006804352 6:36778622-36778644 AGCTGGTGGTGCCATTCTGTGGG - Intronic
1006951241 6:37822570-37822592 AGGTGCTGGCCCCATACTCTGGG + Intronic
1007036068 6:38674894-38674916 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1007076114 6:39067381-39067403 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1007209448 6:40180554-40180576 AGATGCTAGTGCTATGCTCATGG - Intergenic
1007281715 6:40717576-40717598 AGATGCCAGTGCCATGCTCTCGG + Intergenic
1007523338 6:42468597-42468619 AGCTGCTGGTGCCCTGATCTTGG - Intergenic
1007720394 6:43881712-43881734 AGATGCCAGTGCCATACTCTTGG + Intergenic
1008141836 6:47840647-47840669 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1008197891 6:48547563-48547585 AGACGCCAGTGCCATTCTCTAGG + Intergenic
1008637990 6:53431597-53431619 AGATGCTGGTGCCTTGATCTTGG + Intergenic
1008861473 6:56154257-56154279 AAATACTAGTGTCATGCTCTTGG + Intronic
1009530803 6:64811770-64811792 AGATGCCTATGCCATGCTCTTGG + Intronic
1009618516 6:66041870-66041892 AGATGCTGGTTCCCTGCTCTTGG - Intergenic
1009623136 6:66101264-66101286 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1009692477 6:67054153-67054175 AGATGCCAATGCCATGCTCTTGG - Intergenic
1009786669 6:68349320-68349342 AGATGCCAGTACCATGTTCTTGG - Intergenic
1009990122 6:70832631-70832653 AGATGCTGGAGCTGTCCTCTTGG - Intronic
1010225415 6:73484340-73484362 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1010604921 6:77876457-77876479 AGATGCTGGCACCGTGCTCCTGG + Intronic
1011139450 6:84136318-84136340 AGATGCCAGTGCCATGCATTTGG - Intronic
1011217286 6:85018454-85018476 AAATTGTGTTGCCATGCTCTAGG - Intergenic
1011626807 6:89289831-89289853 AGATGTGAGTGCCATGCTCTTGG - Intronic
1011633322 6:89348282-89348304 ACACTCTGGAGCCATGCTCTAGG + Intronic
1011936505 6:92785075-92785097 AGATACCAGTTCCATGCTCTCGG + Intergenic
1011984915 6:93431193-93431215 AGATGCCAGTGCCATCCTCTTGG + Intergenic
1012024527 6:93971962-93971984 AGATGCTGGCGCATTGGTCTTGG - Intergenic
1012061347 6:94486702-94486724 AGATGCCAGAGCCATGCTCTTGG + Intergenic
1012194987 6:96330348-96330370 AGATGTCAGTGCCATGCTCTTGG + Intergenic
1012473357 6:99594931-99594953 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1012886591 6:104853210-104853232 CGATGCTGGTGCCACACTGTTGG + Intronic
1012919107 6:105202723-105202745 AGATGCTGATGCCATACTCTTGG + Intergenic
1012956108 6:105571971-105571993 AGATGCTAGTGTTGTGCTCTTGG - Intergenic
1013071766 6:106735981-106736003 AGATGCAGGTGCCATGCCCTTGG + Intergenic
1013386212 6:109634324-109634346 GGATGCCAGTGCCATGCACTTGG + Intronic
1013594126 6:111645650-111645672 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1013749251 6:113383474-113383496 AAATGCTGGTGCCTTGATCTTGG - Intergenic
1013869437 6:114739461-114739483 AGATGCTGGTGCCATGATTTTGG + Intergenic
1013981035 6:116129616-116129638 AGATACCGGTGCCATCCTCTTGG + Intronic
1014317317 6:119884052-119884074 ATATGCCAGTGCCATGCTCTTGG + Intergenic
1014346144 6:120272238-120272260 AGATGCCAGTGCCATGCTCTTGG - Intergenic
1014363845 6:120515716-120515738 AGATGCTAGTGTCATGTTCTTGG - Intergenic
1014577411 6:123090696-123090718 ATATGCTGGTGCCTTGATTTTGG - Intergenic
1014805661 6:125826828-125826850 AGATGCTGGCACCATGCTCTTGG - Intronic
1015333592 6:132009359-132009381 AGATGCTATTGCCATGCTCTTGG + Intergenic
1015439556 6:133232561-133232583 CAATGCTGCTGCCATGCTCTTGG - Intergenic
1015439812 6:133234797-133234819 AGATATTCGTGCCATGCTCTTGG - Intergenic
1015470290 6:133597636-133597658 ACCTGCTGGTGCCTTGATCTGGG + Intergenic
1015550869 6:134411239-134411261 AGAAGCTGCCACCATGCTCTTGG - Intergenic
1015551138 6:134413584-134413606 AGAAGCTGCTGCCATGCCCTTGG - Intergenic
1015615581 6:135071179-135071201 AAATGCTGGTGCTATGCTCTTGG - Intronic
1015758010 6:136627721-136627743 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1015821369 6:137264504-137264526 AGATGCTGGCACCATGCCTTTGG + Intergenic
1015935880 6:138405062-138405084 AAATACCGGTGCCATGATCTCGG - Intronic
1016409533 6:143767619-143767641 AAATGCTGCTGCCTTGATCTTGG - Intronic
1016465929 6:144325441-144325463 AGATGCCAGTGCCATGCTTTTGG + Intronic
1016533312 6:145083109-145083131 AAATGCTGGCGCCCTGTTCTCGG + Intergenic
1016536604 6:145113430-145113452 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1016562168 6:145408779-145408801 ATATGCTGGTGCCTTGATCTTGG - Intergenic
1016706880 6:147119084-147119106 AGATGCTTGTGCCATGCCCTTGG + Intergenic
1017033687 6:150247986-150248008 AGATGCCAGTGCCATGCTCTTGG - Intronic
1017192362 6:151668146-151668168 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1017468247 6:154714985-154715007 AGATGCCAGTGCCATGTTCTTGG + Intergenic
1017606738 6:156142737-156142759 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1017840541 6:158218666-158218688 AGATGCTGGTGCCATGCTCTTGG + Intergenic
1017937257 6:159016748-159016770 ATCTGCTGGTGCTATGATCTTGG - Intergenic
1017952337 6:159146570-159146592 CGATGCTGGTACCTTGATCTTGG - Intergenic
1017976832 6:159365616-159365638 AGATGCTAGTGCCATGTTCTTGG + Intergenic
1018006029 6:159622837-159622859 AGATGCTGGTACCTTGATATTGG - Intergenic
1018045314 6:159960665-159960687 CGATGCTGGCACCATGCTCTTGG - Intergenic
1018249199 6:161851295-161851317 AGATGCAGGCCCCATGATCTTGG + Intronic
1018285549 6:162233888-162233910 AGATGCCGGTGGCATGCTCTTGG + Intronic
1018468413 6:164073953-164073975 AGATGCTGGCAACATGCTCTTGG - Intergenic
1018491004 6:164293378-164293400 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1019085493 6:169471838-169471860 ATCTGCTGGTACCATGATCTTGG - Intronic
1019128900 6:169859503-169859525 TGATGCTGGGGCTATGCTCTGGG - Intergenic
1019132206 6:169885292-169885314 AGATGCTGGTACCATGCTGTTGG - Intergenic
1019314324 7:377469-377491 AGAGGCTGGTTACCTGCTCTGGG - Intergenic
1019608854 7:1925455-1925477 AGAAGCTGGTGCCTTGATCTCGG - Intronic
1019831019 7:3330607-3330629 AGATGCCAGTGCCATGGTCTTGG + Intronic
1019886633 7:3911408-3911430 ATGTGCTGGTGCCTTGGTCTTGG - Intronic
1019957076 7:4424096-4424118 AAAAGCTGGTGCCATGGTATTGG - Intergenic
1019971707 7:4546619-4546641 AGATGCTGGCACCTTGATCTTGG + Intergenic
1020174838 7:5873742-5873764 AGATGCTGGTGGCTTGGGCTAGG + Intergenic
1020356539 7:7281999-7282021 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1020542284 7:9473165-9473187 AGATGCTGTTGCTTTGATCTTGG + Intergenic
1020565743 7:9793467-9793489 ACCTGCTGGTGCCTTGATCTGGG - Intergenic
1020638414 7:10725292-10725314 AGAGGCTGGCACCATGCTCTTGG - Intergenic
1020853553 7:13388870-13388892 AGATGTCAGTACCATGCTCTTGG + Intergenic
1020989633 7:15180868-15180890 AGATGCTGGTGCCCTGCTCTTGG - Intergenic
1021263291 7:18486006-18486028 AGATGCCCTTACCATGCTCTTGG - Intronic
1021477648 7:21080693-21080715 GGATGCTGATGCCAGGCTCTTGG - Intergenic
1021562683 7:21984871-21984893 ACTAGCTGGTGCCATGATCTTGG - Intergenic
1022592771 7:31681515-31681537 AGATTCTTGTGTCTTGCTCTGGG + Intergenic
1022904563 7:34843263-34843285 AGTTGCAAGTGCCCTGCTCTTGG - Intronic
1022934999 7:35165784-35165806 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1023275460 7:38514723-38514745 AGATGCTGATGCCACGCCCTTGG + Intronic
1023312370 7:38901384-38901406 AGATGCTGGTGCCGTGCTTCTGG - Intronic
1023368847 7:39491789-39491811 ATTTGCTGGTGCCTTGATCTTGG + Intronic
1023388382 7:39683114-39683136 AGATGCTGCCACCATGCTCTTGG + Intronic
1023599057 7:41863841-41863863 AGTTGCTAGTGCCATTTTCTTGG - Intergenic
1023672137 7:42588187-42588209 AGATGCTGCTGCCATGCTTCTGG + Intergenic
1023756747 7:43425641-43425663 AGATGCCAGTGCCATGCTACTGG - Intronic
1023831714 7:44042408-44042430 AGATACTAGTGCCATGACCTTGG + Intergenic
1023988886 7:45116066-45116088 AGCTGCTGGTGTCTTGATCTTGG + Intergenic
1024964745 7:55014408-55014430 AGATGCTAGCACCAAGCTCTTGG - Intergenic
1024968986 7:55051532-55051554 AGATGCTGGCACCATGCCCTGGG + Intronic
1024978783 7:55138836-55138858 AGATGCCAATGCCATGCTCTTGG - Intronic
1025002871 7:55331915-55331937 AGATGCTGGTGCCATTCTCTTGG + Intergenic
1025121285 7:56306133-56306155 AGATGCTGATGGCTTGGTCTAGG - Intergenic
1025908154 7:65805243-65805265 ATATGCTGGTGCTCTGATCTCGG + Intergenic
1026105161 7:67415049-67415071 ATCTGTTGGTGCCGTGCTCTTGG - Intergenic
1026253812 7:68693536-68693558 AACTGCTGGTGCCTTGATCTTGG - Intergenic
1026508176 7:71004520-71004542 GGATGCTGATGCCTTGATCTTGG - Intergenic
1027264432 7:76486303-76486325 TGATGCTGTTGACATGCACTTGG - Intronic
1027315802 7:76984417-76984439 TGATGCTGTTGACATGCACTTGG - Intergenic
1027367019 7:77469037-77469059 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1027429101 7:78091380-78091402 AGATATTGGTGCCTTGATCTTGG + Intronic
1027609411 7:80340829-80340851 AGATGCTGGAACCATGCTCTTGG + Intergenic
1027624495 7:80529542-80529564 AGACGTTGATGCCATGCTCTTGG + Intronic
1027785386 7:82573675-82573697 GGATGCTGGCACCCTGCTCTTGG + Intergenic
1027789301 7:82619361-82619383 AGATGATGGTGCTATGCTCCTGG + Intergenic
1027834824 7:83227480-83227502 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1027840724 7:83307988-83308010 GGCTGCTGGTGCCTTGATCTTGG - Intergenic
1028090279 7:86691799-86691821 AGATGCTGGCACCTTGATCTTGG + Intronic
1028313320 7:89367304-89367326 AGATGCTGGTTCCATGCCTCTGG - Intergenic
1028629077 7:92913917-92913939 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1029083940 7:97996886-97996908 AGATGCTGGTGGCTTGGGCTGGG - Intergenic
1029196602 7:98809882-98809904 AGATGCTGGTGCCATGCTCTTGG + Intergenic
1029408810 7:100395411-100395433 AGATGCTGGCACCTTGATCTTGG + Intronic
1029620917 7:101689214-101689236 AGATGCCCTTGCCATGCCCTGGG + Intergenic
1029642534 7:101830066-101830088 AGATGCTGGGGCTATGCCCCTGG + Intronic
1029952578 7:104602786-104602808 AGATGCTAGTACTATGCTCTTGG - Intronic
1029963413 7:104712302-104712324 AGCTGCTGGTACCTTGATCTTGG - Intronic
1030015358 7:105214201-105214223 AGATGCTGTAGCACTGCTCTAGG + Intronic
1030190937 7:106809419-106809441 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1030203438 7:106928990-106929012 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1030524743 7:110639559-110639581 ACAGGATAGTGCCATGCTCTGGG + Intergenic
1030533808 7:110741572-110741594 ATCTGTTGGTGCCATGATCTTGG + Intronic
1030601814 7:111601741-111601763 AGATGCTGGCACCATGCTTTTGG - Intergenic
1030674199 7:112367606-112367628 AGATGCCAGTGCCATACTCTTGG - Intergenic
1030697233 7:112599216-112599238 AGATGCTGGCACCATATTCTTGG - Intergenic
1030910705 7:115245607-115245629 AAACACTAGTGCCATGCTCTTGG - Intergenic
1031016158 7:116578864-116578886 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1031308427 7:120163473-120163495 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1031332469 7:120482699-120482721 AGATGCTGGCACCATGCTCTTGG + Intronic
1031348319 7:120696789-120696811 AGATGCCAGCACCATGCTCTTGG + Intronic
1032097812 7:128948161-128948183 AGAGGCTGGAACCATGCCCTGGG - Intronic
1032158492 7:129490956-129490978 AGATACCAGCGCCATGCTCTTGG - Intergenic
1032565309 7:132935837-132935859 AGATGCTGGCGCCATGCCCTTGG - Intronic
1032583160 7:133122244-133122266 AGATGCTGGTGCTGTGCTATTGG + Intergenic
1032623890 7:133567702-133567724 AGATGCCAGTGCCATGCTCTGGG - Intronic
1033183622 7:139204727-139204749 AGATGCTGGTGCCTTGATTTTGG + Intergenic
1033215767 7:139492460-139492482 AGAAGCTGCTGCCATGCCCTTGG - Intergenic
1033780391 7:144662393-144662415 AGCTGCTAGTGCGATGATCTTGG + Intronic
1034563681 7:151897095-151897117 AGATGCTGGCTCCATGCTTTGGG - Intergenic
1034707725 7:153161399-153161421 AGATGCTGGTTCCATGCTCTTGG - Intergenic
1034716458 7:153247126-153247148 ATCTGCTGGTGCCCTGCTCTTGG + Intergenic
1034850014 7:154484665-154484687 AGATGCTGGTGCCAGCCACATGG - Intronic
1035034272 7:155884989-155885011 AGAGGCTGGTGGCATTCTCTTGG + Intergenic
1035962044 8:4148111-4148133 TGATGCGCGTGACATGCTCTGGG + Intronic
1036443536 8:8802530-8802552 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1036666507 8:10746803-10746825 AGATGCCAGTGCAATGCTCTTGG - Intronic
1036737838 8:11334098-11334120 AGATGCTGGCACCATGCTCTTGG + Intergenic
1036799274 8:11777819-11777841 AGATGCCAATGCCATGCCCTTGG - Intronic
1037002043 8:13731817-13731839 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1037386037 8:18343020-18343042 AGAAGCTGGTGCCTTGATCTTGG - Intergenic
1038213904 8:25544138-25544160 AGATGCCAGCACCATGCTCTTGG - Intergenic
1038343098 8:26705512-26705534 AGATGCTGGCGCCATGCTCTTGG + Intergenic
1038402076 8:27291754-27291776 AGATGCTGGTGCCATGCTCTTGG - Intronic
1038708983 8:29923055-29923077 TGATGCCAGTGCCATGTTCTTGG - Intergenic
1038746006 8:30255569-30255591 AGATGCCAGTGCCATGCTTTTGG + Intergenic
1038854573 8:31317357-31317379 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1038984884 8:32797617-32797639 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1039090143 8:33819315-33819337 AGATGCCAGTGCCATGCTCTTGG - Intergenic
1039211553 8:35220780-35220802 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1039235681 8:35500217-35500239 AGATGCTAGCACTATGCTCTTGG - Intronic
1039273012 8:35903522-35903544 AGATGCGAGTGCCATGCTTGTGG + Intergenic
1039274733 8:35923013-35923035 AAATGCTGGTGCCTTAATCTTGG - Intergenic
1039406058 8:37313599-37313621 AGATACTGTTGCCTTGATCTTGG - Intergenic
1039425626 8:37483214-37483236 AGATGCTGGTGTCATGATCTTGG + Intergenic
1039506825 8:38058252-38058274 AGATGCGGGCACCATGCCCTTGG - Intronic
1039508459 8:38069786-38069808 AGATGCTTGTGCCATGCCCTTGG - Intergenic
1039886033 8:41654305-41654327 AGAGGCCGGGGCCAGGCTCTGGG - Intronic
1040441724 8:47450214-47450236 AAATAGTGGTGCTATGCTCTTGG - Intronic
1040462576 8:47662920-47662942 ACCTGCTGGTGCCTTGATCTGGG + Intronic
1040824453 8:51605960-51605982 AGATGCTAGTGCCATGCACTCGG + Intronic
1040885764 8:52262034-52262056 AGATGCTGGTGCCACGCTCTTGG - Intronic
1040984568 8:53279709-53279731 ACCTGCTGGTGCCTTGATCTTGG + Intergenic
1040987632 8:53313949-53313971 CCATGCTGGTGCCTTGATCTTGG - Intergenic
1041223170 8:55671736-55671758 AGATGCCAGCACCATGCTCTTGG + Intergenic
1041300219 8:56403820-56403842 ATCTGCTGGTGCCTTGTTCTTGG + Intergenic
1041640883 8:60200204-60200226 ACCTGCTGGTGCCTTGATCTTGG + Intronic
1041718624 8:60955578-60955600 AAATGCCAGTGCTATGCTCTTGG + Intergenic
1042309400 8:67365398-67365420 AGGTGCTGGCAACATGCTCTTGG + Intergenic
1042357208 8:67841345-67841367 ATGTGCTGGTGCCTTGATCTTGG - Intergenic
1042501845 8:69517095-69517117 AGATGCTGGCACCATGCTCTTGG - Intronic
1042624435 8:70741360-70741382 AGATGCTAGTGCTATGCTCTTGG + Intronic
1042699223 8:71594021-71594043 AGATGCTGACACCATGCCCTTGG + Intergenic
1042935234 8:74051783-74051805 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1042935479 8:74053954-74053976 AGATGCTGGTGCTGTGCTTTTGG + Intergenic
1043202723 8:77390992-77391014 AGATGCTGGTGCCATTCTCTTGG + Intergenic
1043246976 8:78015793-78015815 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1043379790 8:79690294-79690316 AGCTGCTGGTGCCTTGATCTTGG - Intergenic
1043585627 8:81766051-81766073 ATCTGCTGGTGCCATGATCTTGG + Intergenic
1044184107 8:89231745-89231767 AGCTGCTGGTGACTTGATCTTGG - Intergenic
1044395987 8:91713126-91713148 AGATGCCAGTGCTGTGCTCTTGG + Intergenic
1044443759 8:92249898-92249920 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1044608623 8:94070123-94070145 AGATGCTGGTGCCATGTTCTTGG - Intergenic
1044657803 8:94566337-94566359 AGATGTTAGTGCCTTGATCTTGG + Intergenic
1044755196 8:95454350-95454372 AGATGCTGGTGCCATGCTCTTGG - Intergenic
1044839013 8:96322352-96322374 AGATACTGGTACCACGCTCTTGG - Intronic
1045289737 8:100822521-100822543 AGATGCCAGCGCTATGCTCTGGG + Intergenic
1045301453 8:100914226-100914248 AGAGGGTGATGCCAGGCTCTGGG - Intergenic
1045313369 8:101022889-101022911 AAATGCCAGTGCCATGCTCTTGG + Intergenic
1045683216 8:104684738-104684760 AGATGCCAGGGCCATGCTCTTGG - Intronic
1045804477 8:106141426-106141448 AGATGCTGGTGTCATGCACTTGG + Intergenic
1045929958 8:107610484-107610506 AGATGTTGATGCCATGCTCTTGG + Intergenic
1046504347 8:115117712-115117734 AGATGCTGGAGCCATGATCCTGG + Intergenic
1046519523 8:115306442-115306464 AGATGCTGGCTCCTTGATCTTGG + Intergenic
1046738562 8:117804337-117804359 ATCTGCTGGTGCCTTGATCTGGG + Intronic
1046773393 8:118138545-118138567 ATATGTTGGAGCCTTGCTCTTGG + Intergenic
1046831657 8:118752756-118752778 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1046886064 8:119368479-119368501 AGATGGTGGTGCCATTAACTTGG - Intergenic
1046902370 8:119536959-119536981 ATCTGCTGGTGCCTTGGTCTCGG + Intergenic
1047250603 8:123179399-123179421 AGATACTGGCACCATGCTTTTGG + Exonic
1047452831 8:124981705-124981727 AGATGCTGGCCCCATGCTCTTGG - Intergenic
1047461436 8:125069259-125069281 AGATGCTGGCACCATGCTCTTGG + Intronic
1047668052 8:127114135-127114157 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1047836843 8:128703162-128703184 AGATGCCATTGCCATGCTCTTGG - Intergenic
1047857844 8:128931886-128931908 AGACACTGGTGCCTCGCTCTAGG + Intergenic
1047874512 8:129121020-129121042 AGATGTTGGCACCATACTCTTGG + Intergenic
1048077340 8:131086025-131086047 TGATGCTTGCACCATGCTCTTGG + Intergenic
1048439804 8:134451460-134451482 AGATGCTGGTGGCAGGCTCATGG - Intergenic
1048602758 8:135935698-135935720 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1048885701 8:138907721-138907743 GGATGCCTGTGCCATGCACTGGG - Intronic
1049036490 8:140080428-140080450 AGATGCCAGTGCCATGCTTGTGG - Intronic
1049111111 8:140644062-140644084 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1049286559 8:141778608-141778630 AGAAGCTGCTGCCCTGCCCTTGG + Intergenic
1049440085 8:142605504-142605526 AGATGCTGGCGCCATGCTGCTGG - Intergenic
1050005814 9:1129069-1129091 ATATGCTGGAGCCTTGATCTTGG + Intergenic
1050103928 9:2146116-2146138 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1050249670 9:3731570-3731592 AGATGCTGGGGCCATGCTATTGG - Intergenic
1050352239 9:4751323-4751345 AGATGCTGGCACCCTGCTCTTGG - Intergenic
1050503499 9:6323332-6323354 AGATGCTGGTGGCTTGATATTGG - Intergenic
1050528248 9:6564553-6564575 AGATGCTTTTGCCCTGCTCTCGG + Intronic
1050605408 9:7296006-7296028 AGATGCTGGTGCCTTGATCTTGG + Intergenic
1050755401 9:8996605-8996627 ATCTGCTGGTGCCTTGGTCTTGG - Intronic
1051421016 9:16889422-16889444 AGATGCCAGTGCCATGGTCTTGG - Intergenic
1051421144 9:16890562-16890584 AGATGCTGGCACCTTGATCTTGG - Intergenic
1051446622 9:17146619-17146641 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1051512104 9:17889490-17889512 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1051519966 9:17975361-17975383 ATCTGCTGGTGCCCTGATCTTGG - Intergenic
1051748293 9:20316534-20316556 AGATGTCAGTGCCATGCTGTCGG - Intergenic
1051884845 9:21880282-21880304 AGATGCCAGTGCCATACTCTTGG + Intronic
1051922867 9:22288214-22288236 TGATGCTGGTGGCTTGATCTTGG - Intergenic
1052035602 9:23676883-23676905 AAATGCTGGTGTCATGCTCTTGG + Intergenic
1052254113 9:26433646-26433668 AGATGCTGGCACCATGCTCTTGG - Intergenic
1052353280 9:27479170-27479192 AGTTGCTGGTGCCTTGCTCTTGG - Intronic
1052507692 9:29377211-29377233 ATAGCCTGGTGCCATGCCCTGGG + Intergenic
1052555136 9:30003106-30003128 AGATGCTGGAGGCTTGATCTTGG + Intergenic
1052782280 9:32793851-32793873 AGATACTGGTGGCTTGATCTTGG + Intergenic
1053183946 9:35998527-35998549 AGATGCCAGTGTCATGCTCTTGG + Intergenic
1053185825 9:36015587-36015609 ACATGTTGGTGCCTTGATCTTGG - Intergenic
1053200045 9:36146146-36146168 AGATGCCAATGCCATGCTCTTGG - Intronic
1054806582 9:69401624-69401646 AGAAGCTGTCACCATGCTCTTGG - Intergenic
1055023411 9:71694030-71694052 ATTTGCTGGTGCCTTGCCCTTGG + Intronic
1055073071 9:72187446-72187468 AGATGCTGGTGCCATGCTCTTGG + Intronic
1055388653 9:75794459-75794481 AGATGCCAGCACCATGCTCTTGG - Intergenic
1055465239 9:76558950-76558972 AGATGCTGGGGCCATGCCCTTGG + Intergenic
1055529055 9:77165112-77165134 AGACATTGGTGCCTTGCTCTTGG + Intergenic
1055824906 9:80312010-80312032 AAATGCTGGTGCCTTGATCTTGG + Intergenic
1055840105 9:80493480-80493502 AGATGCTGACACCATGCTTTTGG - Intergenic
1056209139 9:84348848-84348870 AGCGGCTAGTGCCATGCTCTTGG + Intergenic
1056540200 9:87564505-87564527 AGATGCTGGTGACATGGTCTTGG - Intronic
1056714836 9:89020543-89020565 AGTTTCTGGTGCCAGGATCTAGG + Intronic
1056743650 9:89282075-89282097 AGATGCTGGTGCCTTGATCTTGG + Intergenic
1056782140 9:89558688-89558710 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1056789339 9:89615603-89615625 ACCTGCTGGTGCCCTGATCTTGG + Intergenic
1056955410 9:91077155-91077177 AGATGCTGGTCCCTCGATCTTGG - Intergenic
1056969249 9:91188867-91188889 AGATGCTGGTGCCATGCTTCCGG - Intergenic
1057107444 9:92433159-92433181 AAATGCTGGTGCCTTGATCTTGG - Intronic
1057339534 9:94187513-94187535 AGATGCTGGTGCTTTGATCTTGG - Intergenic
1057557897 9:96102227-96102249 AGATGCTGGTGCCATGCTTCTGG - Intergenic
1057595098 9:96409181-96409203 AGATTCTGGTGCCATGCCTCTGG + Intronic
1057754616 9:97822215-97822237 AGATGATGGCTCCATGCTTTTGG - Intergenic
1057871085 9:98718319-98718341 GTCTGCTGGTGCCTTGCTCTTGG - Intergenic
1058032224 9:100212966-100212988 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1058045870 9:100355930-100355952 AGATGCTGATGCCACACTCTTGG - Intergenic
1058047548 9:100372889-100372911 ACATGTTGGCACCATGCTCTTGG - Intergenic
1058395566 9:104549632-104549654 AGATGCCAGCACCATGCTCTTGG + Intergenic
1058478741 9:105369294-105369316 ATTTGCTGGTGCCTTGTTCTTGG - Intronic
1058638592 9:107060708-107060730 AGATGCTGGCACCTTGATCTTGG - Intergenic
1058725361 9:107798248-107798270 AGATGCTGGTATCATGCTCTTGG - Intergenic
1058777354 9:108297418-108297440 AGATGCCAGAGCCATGCTCTTGG - Intergenic
1059125492 9:111680661-111680683 AGATGCTCGTGCCATGCTTTCGG - Intergenic
1059293743 9:113250986-113251008 AGATGCTGGCACCATGCTCTTGG + Intronic
1059370746 9:113831579-113831601 AGATGCTGGCACCATGCTCTTGG + Intergenic
1059477170 9:114556769-114556791 AGAAGCCAGTGCCATTCTCTTGG + Intergenic
1059507705 9:114814689-114814711 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1059585643 9:115603250-115603272 CGCTGGTGGTCCCATGCTCTTGG - Intergenic
1059877014 9:118646101-118646123 AGATGTTGGCACCATGCTCTTGG + Intergenic
1060043315 9:120320345-120320367 ACCTGCTGGTGCCTTGATCTTGG - Intergenic
1060087905 9:120717993-120718015 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1060246147 9:121947918-121947940 TTATGCTGGTGCCGTGCTTTTGG + Intronic
1060658026 9:125386293-125386315 AGATGCTGGTCCTTTGATCTTGG - Intergenic
1060878672 9:127102282-127102304 AAATGCTGGCACCATGCTCCTGG - Intronic
1061272661 9:129552198-129552220 AGATGCTGGGGCTATGCAGTGGG + Intergenic
1061915149 9:133747206-133747228 AGATGCTGATGCCTTGATCTTGG + Intergenic
1185516576 X:703499-703521 AGATGATGGTGCCTTGGTCTTGG - Intergenic
1185516690 X:704572-704594 AGATGATGGTGCCTTGGTCTTGG + Intergenic
1185733120 X:2477159-2477181 AGAAGCTGTTTCCCTGCTCTGGG + Intronic
1185919514 X:4074862-4074884 AGATGCTGACACTATGCTCTTGG + Intergenic
1186094356 X:6083350-6083372 AGATGATGGTGCCTTGATCCTGG + Intronic
1186094490 X:6084826-6084848 AGATCATGGTGCCTTGATCTTGG + Intronic
1186170115 X:6867834-6867856 AGATACTGGTGTCATGCTGTTGG - Intergenic
1186676374 X:11821699-11821721 AAATGCTGGTCCCTTGATCTTGG + Intergenic
1186683708 X:11902323-11902345 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1186702234 X:12103993-12104015 AGAGGCTAGTACTATGCTCTTGG - Intergenic
1186734264 X:12444656-12444678 AGATGTCAGTGTCATGCTCTTGG - Intronic
1186745949 X:12569125-12569147 AGATGCTGACACCACGCTCTTGG + Intronic
1186835488 X:13433334-13433356 AAATGCTGATGCCATGCTCTTGG - Intergenic
1186845733 X:13529186-13529208 AGATGCTGGATCCTTGATCTTGG - Intergenic
1187049091 X:15678531-15678553 AGATGCTGGCACCATGCCCTTGG - Intergenic
1187550007 X:20293091-20293113 AGATGCTGGCACCATGCTCTTGG + Intergenic
1187971109 X:24659657-24659679 AGATGCTGGCACCATGCTTTTGG - Intronic
1188082048 X:25855141-25855163 AGATCCCAGTGCCATGCTCTTGG + Intergenic
1188134079 X:26472494-26472516 ATCTGCTGGTGCCTTGATCTTGG + Intergenic
1188627570 X:32305558-32305580 AGATGCTGGTGGCTTGGACTTGG - Intronic
1188890177 X:35601604-35601626 AGATGCCAGTGCCATGTTCTTGG - Intergenic
1188901555 X:35739070-35739092 TGTTGCTGGTGCCTTGATCTTGG - Intergenic
1189080072 X:37961291-37961313 AGATGTCGATGCCATGCTCTTGG - Intronic
1189170231 X:38901851-38901873 CCATGCTGGTGCCTTGATCTTGG + Intergenic
1189244617 X:39553905-39553927 AGATGCTAGCACCATGCTCTTGG + Intergenic
1189255156 X:39632310-39632332 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1189256096 X:39640644-39640666 GAATGCTGGTGCCTTGATCTTGG + Intergenic
1189305326 X:39982617-39982639 AGATGCCGGTGCCTTGATTTTGG - Intergenic
1189582125 X:42417729-42417751 AGATGCTGGCTCCTTGATCTTGG - Intergenic
1189721931 X:43928785-43928807 GGATGCCAGTACCATGCTCTTGG - Intergenic
1189904246 X:45741673-45741695 AAATGTTGGTGCCTTGATCTTGG + Intergenic
1189963622 X:46349760-46349782 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1190033648 X:46999053-46999075 AGAAGCTGCTGCCATGCCCTTGG - Intronic
1190145277 X:47885557-47885579 AGCTGCTGGTGCCTTTATCTTGG - Intronic
1190170098 X:48105495-48105517 AGATGCCAGCGCCATGTTCTTGG + Intergenic
1190188015 X:48252851-48252873 AGATGCCAGCGCCATGTTCTTGG + Intronic
1190211786 X:48454603-48454625 AGATGCTGGTGCCTTGATCTTGG + Intergenic
1190270831 X:48862034-48862056 AGTTGCTGGTCCCTTGATCTTGG + Intergenic
1190656899 X:52620614-52620636 AGATGCCAGCGCCATGTTCTTGG + Intergenic
1190922263 X:54865271-54865293 AGATGCCAGAACCATGCTCTTGG - Intergenic
1191696097 X:63992421-63992443 AGATGCCTATGCCATGTTCTTGG + Intergenic
1191868456 X:65725078-65725100 AGGTGCTGGTGCCATGCTCTTGG - Intronic
1192102005 X:68274624-68274646 ATCTGCTGGTGCTTTGCTCTTGG - Intronic
1192123648 X:68480072-68480094 AGATGCTGGTGCAATGCTCTTGG + Intergenic
1192207089 X:69103516-69103538 AGAAGATGCTGCCCTGCTCTTGG - Intergenic
1192217780 X:69175909-69175931 AGATGCCAGTGCCATGCTCTTGG + Intergenic
1192594197 X:72388889-72388911 CCATGCTGGTGCCTTGATCTTGG + Intronic
1192705075 X:73520712-73520734 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1193431939 X:81418601-81418623 GGATGCCAGTGCCATGCTATTGG - Intergenic
1193967217 X:88003869-88003891 CAATGCTAGTGACATGCTCTTGG - Intergenic
1194307593 X:92267794-92267816 AGATGCTGGTACCTTGATATTGG - Intronic
1194334712 X:92630865-92630887 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1194412664 X:93576398-93576420 AGATGCTGGCACCCTGATCTTGG + Intergenic
1194490837 X:94546948-94546970 AGATGCTGGTGGCTTAATCTCGG + Intergenic
1194547637 X:95257502-95257524 AGATGTGGGCACCATGCTCTTGG - Intergenic
1195295466 X:103472235-103472257 AGATGCTGGAGCCATGCTTTTGG + Intergenic
1195311316 X:103634246-103634268 AGATGCCAGTGCCTTGATCTTGG + Intergenic
1195406018 X:104514288-104514310 CCATGTTGGCGCCATGCTCTTGG - Intergenic
1195407777 X:104535488-104535510 AGATGCTAGTGCCATGATCTTGG + Intergenic
1195462773 X:105146073-105146095 ATCTGCTGGTGCCTTGATCTTGG + Intronic
1195513496 X:105745080-105745102 ATCTGCTGGTGCCTTGATCTTGG - Intronic
1195748461 X:108141650-108141672 AGATGTTGGTTCCTTGCACTTGG + Intronic
1195913074 X:109908503-109908525 AAATGCTGGTGCAGTGCTCTTGG + Intergenic
1195977656 X:110544865-110544887 AGATGCTGGTGACTTGAACTTGG + Intergenic
1196076331 X:111580957-111580979 AGATGCCAGTGCCATGCTCTTGG - Intergenic
1196263101 X:113608889-113608911 AGATGCTGATGCCTTGATCTTGG - Intergenic
1196281976 X:113832763-113832785 AAGTGCTGGTGCCTTGATCTTGG - Intergenic
1196412876 X:115438566-115438588 AGATGTTGGTGCCATGCTCTTGG + Intergenic
1196581070 X:117379714-117379736 CAATGCTGGCACCATGCTCTTGG - Intergenic
1196723628 X:118877151-118877173 AGATGCTGGCTCCATGCTCTTGG + Intergenic
1196813142 X:119644453-119644475 GAATGCTGGTGCCTTGATCTTGG - Intronic
1197271085 X:124425579-124425601 AGCTGCCAGTGCCATGCTCTTGG + Intronic
1197342798 X:125293558-125293580 AAATGTTGGTGCCATGCTCTTGG - Intergenic
1197442050 X:126503686-126503708 AGATGCTAGTGCCATGCTTTTGG - Intergenic
1197559550 X:128000590-128000612 AAATGCTGGTGCCATGTTTCTGG + Intergenic
1197707070 X:129641635-129641657 AGACGCCAGTGCCATGCCCTTGG - Intergenic
1198053994 X:132975901-132975923 AGATGCTGGCACCATGCTTCCGG + Intergenic
1198317181 X:135479776-135479798 ATTTGCTGGTGCCTTGATCTTGG + Intergenic
1198798107 X:140421163-140421185 GGATATTGGTACCATGCTCTTGG - Intergenic
1198800883 X:140446592-140446614 ACATGGTGGTGCCATTCACTGGG - Intergenic
1198920604 X:141721819-141721841 AGATGCCAGGGCCATGGTCTTGG - Intergenic
1199371768 X:147057855-147057877 AGATGCTGGAGCCATGCTCTTGG + Intergenic
1199549167 X:149039886-149039908 AGATGCTGGTGCCTTGATCTTGG - Intergenic
1199585005 X:149405463-149405485 AGATGCTAGTGCCATGCTCTTGG + Intergenic
1199589330 X:149451592-149451614 AGATGCTGGCACCTTGATCTTGG - Intergenic
1199845039 X:151686669-151686691 ATCTGCTGGTGCCTTGATCTTGG - Intergenic
1200007090 X:153094141-153094163 AGATGCTGGTGCCTTGAGCTTGG - Intergenic
1200243442 X:154509635-154509657 AGATGCCGGCGCCATGCTTTTGG - Intronic
1200274750 X:154721344-154721366 AGATGCTGGTGCTATGCCTTTGG - Intronic
1200643190 Y:5747918-5747940 ATCTGCTGGTGCCTTGTTCTTGG - Intergenic
1201486814 Y:14503642-14503664 ATATGCTTGTGCCTTGATCTTGG + Intergenic
1201493035 Y:14563605-14563627 AGAAGCTGGTGCCATTCCTTTGG - Intronic
1201503817 Y:14675681-14675703 AGATGATGGTGCCTTGATCTTGG - Intronic
1201560451 Y:15310616-15310638 ACATACTGGTGTCATGCTGTTGG - Intergenic