ID: 1074009127

View in Genome Browser
Species Human (GRCh38)
Location 10:109458651-109458673
Sequence GCAATAGGATCCTCATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074009127_1074009129 -8 Left 1074009127 10:109458651-109458673 CCATCTGATGAGGATCCTATTGC No data
Right 1074009129 10:109458666-109458688 CCTATTGCAGTGTCATCCCATGG No data
1074009127_1074009130 -1 Left 1074009127 10:109458651-109458673 CCATCTGATGAGGATCCTATTGC No data
Right 1074009130 10:109458673-109458695 CAGTGTCATCCCATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074009127 Original CRISPR GCAATAGGATCCTCATCAGA TGG (reversed) Intergenic
No off target data available for this crispr