ID: 1074009130

View in Genome Browser
Species Human (GRCh38)
Location 10:109458673-109458695
Sequence CAGTGTCATCCCATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074009124_1074009130 27 Left 1074009124 10:109458623-109458645 CCAAGAGCATGGCACCAGCATCT 0: 27
1: 81
2: 206
3: 346
4: 989
Right 1074009130 10:109458673-109458695 CAGTGTCATCCCATGGAAGAAGG No data
1074009127_1074009130 -1 Left 1074009127 10:109458651-109458673 CCATCTGATGAGGATCCTATTGC No data
Right 1074009130 10:109458673-109458695 CAGTGTCATCCCATGGAAGAAGG No data
1074009125_1074009130 13 Left 1074009125 10:109458637-109458659 CCAGCATCTGCTCACCATCTGAT No data
Right 1074009130 10:109458673-109458695 CAGTGTCATCCCATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074009130 Original CRISPR CAGTGTCATCCCATGGAAGA AGG Intergenic
No off target data available for this crispr