ID: 1074010884

View in Genome Browser
Species Human (GRCh38)
Location 10:109478280-109478302
Sequence TTGCAAACACAAAATTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074010884_1074010886 11 Left 1074010884 10:109478280-109478302 CCTGTATAATTTTGTGTTTGCAA No data
Right 1074010886 10:109478314-109478336 AAACCTGTTGATAGTCATGGAGG No data
1074010884_1074010885 8 Left 1074010884 10:109478280-109478302 CCTGTATAATTTTGTGTTTGCAA No data
Right 1074010885 10:109478311-109478333 TTAAAACCTGTTGATAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074010884 Original CRISPR TTGCAAACACAAAATTATAC AGG (reversed) Intergenic
No off target data available for this crispr